WormBase Tree Display for Variation: WBVar00142817
expand all nodes | collapse all nodes | view schema
WBVar00142817 | Evidence | Paper_evidence | WBPaper00005054 | ||
---|---|---|---|---|---|
Name | Public_name | dh7 | |||
Other_name | CE53632:p.Trp404Ter | ||||
CE27206:p.Trp440Ter | |||||
CE30451:p.Trp425Ter | |||||
T13C5.1c.1:c.1211_1212delinsAA | |||||
T13C5.1a.1:c.1319_1320delinsAA | |||||
T13C5.1b.1:c.1274_1275delinsAA | |||||
HGVSg | CHROMOSOME_X:g.6200105_6200106delinsAA | ||||
Sequence_details | SMap | S_parent | Sequence | T13C5 | |
Flanking_sequences | aaatccaacgtttggctaatgttttgccat | gctattccccacaagtaagtggcattatta | |||
Mapping_target | T13C5 | ||||
Type_of_mutation | Substitution | gg | rr | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | AA | ||||
Status | Live | ||||
Affects | Gene | WBGene00000905 | |||
Transcript (3) | |||||
Genetics | Interpolated_map_position | X | -3.45871 | ||
Reference | WBPaper00005054 | ||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000905 Amber_UAG_or_Opal_UGA W(440) to stop | Paper_evidence | WBPaper00005054 | ||
Method | Substitution_allele |