WormBase Tree Display for Variation: WBVar00095133
expand all nodes | collapse all nodes | view schema
WBVar00095133 | Evidence | Paper_evidence | WBPaper00002110 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | p1000 | ||||||
Other_name | W09B12.1.1:c.297G>A | |||||||
CE07569:p.Trp99Ter | ||||||||
HGVSg | CHROMOSOME_X:g.16368542G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | W09B12 | ||||
Flanking_sequences | ctttggagacttttatggttccactatgtg | aatgccaacactaaattatccgaagattgt | ||||||
Mapping_target | W09B12 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002110 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007852 | |||||||
WBStrain00024338 | ||||||||
WBStrain00030800 | ||||||||
WBStrain00040622 | ||||||||
Laboratory | PR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000035 | ||||||
Transcript | W09B12.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | W09B12.1.1:c.297G>A | |||||||
HGVSp | CE07569:p.Trp99Ter | |||||||
cDNA_position | 385 | |||||||
CDS_position | 297 | |||||||
Protein_position | 99 | |||||||
Exon_number | 4/12 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000500341 | |||||||
WBInteraction000500342 | ||||||||
WBInteraction000500343 | ||||||||
WBInteraction000500344 | ||||||||
WBInteraction000500356 | ||||||||
Genetics | Interpolated_map_position | X | 23.8979 | |||||
Mapping_data | In_multi_point | 195 | ||||||
196 | ||||||||
In_pos_neg_data (15) | ||||||||
Description | Phenotype | WBPhenotype:0000124 | Paper_evidence | WBPaper00000514 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Acetylcholinesterase specific activity exhibit a continuous rise in activity per worm from hatching to adulthood(50hr) in both p1000 and N2 animals, however in adult, activity levels are significantly decreased in p1000 animals. | Paper_evidence | WBPaper00000514 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000177 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | class A acetylcholinesterase reduced 100% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001289 | Paper_evidence | WBPaper00000795 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Progeny were assayed for AChE activity showing the characteristic sodium deoxycholate (DOC) resistance of class A. | Paper_evidence | WBPaper00000795 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00002987 | Paper_evidence | WBPaper00000795 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001987 | Paper_evidence | WBPaper00001039 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals contained severely reduced levels of detectable class A AChE activity. | Paper_evidence | WBPaper00001039 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001988 | Paper_evidence | WBPaper00000514 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibits resistance to class A acetylcholinesterase inhibitor Triton X-100. | Paper_evidence | WBPaper00000514 | |||||
Curator_confirmed | WBPerson712 | |||||||
Animals exhibits DOC sensitivity to class B acetylcholinesterase inhibitor sodium deoxychlorate. | Paper_evidence | WBPaper00000514 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002241 | Paper_evidence | WBPaper00051284 | ||||||
Curator_confirmed | WBPerson37651 | |||||||
Remark | Figure 6B | Paper_evidence | WBPaper00051284 | |||||
Curator_confirmed | WBPerson37651 | |||||||
WBPhenotype:0004028 | Paper_evidence | WBPaper00038270 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ace-1(p1000) caused significant defects in slowing behavior (data not shown). | Paper_evidence | WBPaper00038270 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000517 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | no behavioral phenotype alone | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000795 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038270 | |||||||
WBPaper00002110 | ||||||||
WBPaper00001039 | ||||||||
WBPaper00000513 | ||||||||
WBPaper00015981 | ||||||||
WBPaper00000514 | ||||||||
WBPaper00021644 | ||||||||
WBPaper00000795 | ||||||||
WBPaper00051284 | ||||||||
Method | Substitution_allele |