WormBase Tree Display for Variation: WBVar00095126
expand all nodes | collapse all nodes | view schema
WBVar00095126 | Evidence | Paper_evidence | WBPaper00024501 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | p802 | |||||
Other_name | CE31568:p.Gln346Ter | ||||||
M02B7.3a.3:c.952C>T | |||||||
CE31567:p.Gln318Ter | |||||||
M02B7.3b.1:c.1036C>T | |||||||
M02B7.3a.2:c.952C>T | |||||||
M02B7.3a.1:c.952C>T | |||||||
HGVSg | CHROMOSOME_IV:g.3797722G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | M02B7 | |||
Flanking_sequences | gatccaaaggatgctcttcttcgagagtac | aggaggaaatcgctcggctcaagtctatgg | |||||
Mapping_target | M02B7 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024501 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00030794 | ||||||
WBStrain00049023 | |||||||
Laboratory | PR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003884 | |||||
Transcript | M02B7.3a.3 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | M02B7.3a.3:c.952C>T | ||||||
HGVSp | CE31567:p.Gln318Ter | ||||||
cDNA_position | 1196 | ||||||
CDS_position | 952 | ||||||
Protein_position | 318 | ||||||
Exon_number | 6/11 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
M02B7.3a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | M02B7.3a.1:c.952C>T | ||||||
HGVSp | CE31567:p.Gln318Ter | ||||||
cDNA_position | 1050 | ||||||
CDS_position | 952 | ||||||
Protein_position | 318 | ||||||
Exon_number | 7/12 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
M02B7.3a.2 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | M02B7.3a.2:c.952C>T | ||||||
HGVSp | CE31567:p.Gln318Ter | ||||||
cDNA_position | 1641 | ||||||
CDS_position | 952 | ||||||
Protein_position | 318 | ||||||
Exon_number | 7/12 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
M02B7.3b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | M02B7.3b.1:c.1036C>T | ||||||
HGVSp | CE31568:p.Gln346Ter | ||||||
cDNA_position | 1036 | ||||||
CDS_position | 1036 | ||||||
Protein_position | 346 | ||||||
Exon_number | 6/10 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000521350 | ||||||
Genetics | Interpolated_map_position | IV | -2.21234 | ||||
Mapping_data | In_2_point | 364 | |||||
365 | |||||||
In_multi_point | 900 | ||||||
903 | |||||||
906 | |||||||
962 | |||||||
In_pos_neg_data | 1630 | ||||||
1631 | |||||||
Description | Phenotype (33) | ||||||
Phenotype_not_observed (13) | |||||||
Reference | WBPaper00014409 | ||||||
WBPaper00000932 | |||||||
WBPaper00024698 | |||||||
WBPaper00031936 | |||||||
WBPaper00024501 | |||||||
WBPaper00027116 | |||||||
WBPaper00028448 | |||||||
WBPaper00029016 | |||||||
WBPaper00006052 | |||||||
WBPaper00002087 | |||||||
WBPaper00001786 | |||||||
WBPaper00029060 | |||||||
WBPaper00003464 | |||||||
WBPaper00031959 | |||||||
WBPaper00017262 | |||||||
WBPaper00028386 | |||||||
WBPaper00019253 | |||||||
WBPaper00017254 | |||||||
WBPaper00017486 | |||||||
WBPaper00022231 | |||||||
WBPaper00014247 | |||||||
WBPaper00010097 | |||||||
WBPaper00025332 | |||||||
WBPaper00000082 | |||||||
WBPaper00016862 | |||||||
WBPaper00036362 | |||||||
WBPaper00035944 | |||||||
WBPaper00020968 | |||||||
WBPaper00015123 | |||||||
WBPaper00000552 | |||||||
WBPaper00013784 | |||||||
WBPaper00045085 | |||||||
WBPaper00055368 | |||||||
WBPaper00003408 | |||||||
WBPaper00061175 | |||||||
WBPaper00060242 | |||||||
WBPaper00061932 | |||||||
WBPaper00065813 | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |