WormBase Tree Display for Variation: WBVar00095115
expand all nodes | collapse all nodes | view schema
WBVar00095115 | Evidence | Paper_evidence | WBPaper00005148 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | p675 | ||||||
Other_name | C02F4.2a.2:c.775G>A | |||||||
CE46586:p.Asp259Asn | ||||||||
CE07853:p.Asp259Asn | ||||||||
C02F4.2a.1:c.775G>A | ||||||||
C02F4.2c.1:c.775G>A | ||||||||
CE52450:p.Asp259Asn | ||||||||
C02F4.2b.1:c.775G>A | ||||||||
C02F4.2c.2:c.775G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.10498698C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C02F4 | ||||
Flanking_sequences | tttggtccaatgtgtgatcttctctggtca | acccacttgaagatttcggaaacgaaagga | ||||||
Mapping_target | C02F4 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00030784 | |||||||
Laboratory | PR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006527 | ||||||
Transcript | C02F4.2c.2 (12) | |||||||
C02F4.2c.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0 | deleterious_low_confidence | ||||||
PolyPhen | 0.904 | possibly_damaging | ||||||
HGVSc | C02F4.2c.1:c.775G>A | |||||||
HGVSp | CE46586:p.Asp259Asn | |||||||
cDNA_position | 1027 | |||||||
CDS_position | 775 | |||||||
Protein_position | 259 | |||||||
Exon_number | 7/15 | |||||||
Codon_change | Gac/Aac | |||||||
Amino_acid_change | D/N | |||||||
C02F4.2b.1 (12) | ||||||||
C02F4.2a.1 (12) | ||||||||
C02F4.2a.2 (12) | ||||||||
Interactor | WBInteraction000500286 | |||||||
WBInteraction000501865 | ||||||||
WBInteraction000502332 | ||||||||
WBInteraction000502703 | ||||||||
WBInteraction000502705 | ||||||||
WBInteraction000502707 | ||||||||
WBInteraction000504755 | ||||||||
Genetics | Interpolated_map_position | IV | 4.61436 | |||||
Mapping_data | In_multi_point | 4720 | ||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000615 | Paper_evidence | WBPaper00027106 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | In the tax-6(p675) loss-of-function mutant, cilia development, morphology, and OSM-6 motility were intact in amphid, phasmid, and male-specific sensory neurons (unpublished data). | Paper_evidence | WBPaper00027106 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00027106 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000853 | Paper_evidence | WBPaper00027106 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | In the tax-6(p675) loss-of-function mutant, cilia development, morphology, and OSM-6 motility were intact in amphid, phasmid, and male-specific sensory neurons (unpublished data). | Paper_evidence | WBPaper00027106 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00027106 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters). | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (15) | ||||||||
Method | Substitution_allele |