WormBase Tree Display for Variation: WBVar00095091
expand all nodes | collapse all nodes | view schema
WBVar00095091 | Evidence | Paper_evidence | WBPaper00004897 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | oz167 | |||||||
Other_name | Y106G6E.5b.1:c.1111C>T | ||||||||
CE27228:p.Gln364Ter | |||||||||
Y106G6E.5a.1:c.1090C>T | |||||||||
CE20409:p.Gln371Ter | |||||||||
HGVSg | CHROMOSOME_I:g.10224300G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y106G6E | |||||
Flanking_sequences | tccgaggagatcagagaaatgtggaaatca | aaattggggaacaccgatgtggacggttgg | |||||||
Mapping_target | Y106G6E | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | BS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000426 | |||||||
Transcript | Y106G6E.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y106G6E.5a.1:c.1090C>T | ||||||||
HGVSp | CE27228:p.Gln364Ter | ||||||||
cDNA_position | 1090 | ||||||||
CDS_position | 1090 | ||||||||
Protein_position | 364 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y106G6E.5b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y106G6E.5b.1:c.1111C>T | ||||||||
HGVSp | CE20409:p.Gln371Ter | ||||||||
cDNA_position | 1127 | ||||||||
CDS_position | 1111 | ||||||||
Protein_position | 371 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000517334 | ||||||||
Genetics | Interpolated_map_position | I | 4.75749 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00004897 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Partially penetrant embryonic lethality | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000188 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonad arms are misshapened. Gonad arms often had an uneven diameter, with a distended proximal end and/or small branches or extrusions at bends | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Migration of the distal tip cells was frequently misdirected | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00004897 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Both somatic and germ cell corpses persist in ced-12 mutants, leading to an accumulation of dead cell corpses | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000885 | Paper_evidence (2) | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Mutants are deficient in the removal of apoptotic cell corpses | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Persistent cell corpses accumulate. | Paper_evidence | WBPaper00038317 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038317 | ||||||||
WBPaper00010999 | |||||||||
WBPaper00010395 | |||||||||
WBPaper00012463 | |||||||||
WBPaper00022326 | |||||||||
WBPaper00004897 | |||||||||
Method | Substitution_allele |