WormBase Tree Display for Variation: WBVar00095015
expand all nodes | collapse all nodes | view schema
| WBVar00095015 | Evidence | Paper_evidence | WBPaper00006173 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ox276 | |||||
| Other_name | H35N03.1.1:c.616_1032+20del | ||||||
| HGVSg | CHROMOSOME_II:g.6158419_6159142del | ||||||
| Sequence_details | SMap | S_parent | Sequence | H35N03 | |||
| Flanking_sequences | gcttccaaaaatccgcaacggaattcgatt | tgtcataatttaagttttttcaggatatga | |||||
| Mapping_target | H35N03 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00006661 | ||||||
| Laboratory | EG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001373 | |||||
| Transcript | H35N03.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | H35N03.1.1:c.616_1032+20del | ||||||
| cDNA_position | 688-? | ||||||
| CDS_position | 616-? | ||||||
| Protein_position | 206-? | ||||||
| Intron_number | 9-12/17 | ||||||
| Exon_number | 9-12/18 | ||||||
| Interactor | WBInteraction000519412 | ||||||
| Genetics | Interpolated_map_position | II | -0.417995 | ||||
| Description | Phenotype | WBPhenotype:0000637 | Paper_evidence | WBPaper00061174 | |||
| Curator_confirmed | WBPerson13368 | ||||||
| Remark | Daf-7;str-2 mutants show increased dauer formation as compared to daf-7 alone. When exp-1 mutation is introduced into the worms with daf-7; str-2 mutation, there is further increase in the percentage of dauer formation. daf-7;dbl-1 double mutants also show increased percentage of dauer formation like str-2; daf-7. | Paper_evidence | WBPaper00061174 | ||||
| Curator_confirmed | WBPerson13368 | ||||||
| WBPhenotype:0000660 | Paper_evidence | WBPaper00041877 | |||||
| Curator_confirmed | WBPerson6468 | ||||||
| WBPhenotype:0001060 | Paper_evidence | WBPaper00061174 | |||||
| Curator_confirmed | WBPerson13368 | ||||||
| Remark | EXP-1 mutant animals moves away from AWC sensed odors | Paper_evidence | WBPaper00061174 | ||||
| Curator_confirmed | WBPerson13368 | ||||||
| WBPhenotype:0001820 | Paper_evidence | WBPaper00041877 | |||||
| Curator_confirmed | WBPerson6468 | ||||||
| Reference | WBPaper00041877 | ||||||
| WBPaper00006173 | |||||||
| WBPaper00061174 | |||||||
| Method | Deletion_allele |
