WormBase Tree Display for Variation: WBVar00094991
expand all nodes | collapse all nodes | view schema
WBVar00094991 | Evidence | Person_evidence | WBPerson3792 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ox10 | ||||||
Other_name | CE31034:p.Ala702AspfsTer7 | |||||||
K09C8.1.1:c.2105del | ||||||||
HGVSg | CHROMOSOME_X:g.10957209del | |||||||
Sequence_details | SMap | S_parent | Sequence | K09C8 | ||||
Flanking_sequences | aagcacgattgaaaatgaaaaagacaagag | attcaaattttcttcagtgtaagattgtgaaa | ||||||
Mapping_target | K09C8 | |||||||
Type_of_mutation | Deletion | c | ||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006658 | |||||||
Laboratory | EG | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003943 | ||||||
Transcript | K09C8.1.1 | VEP_consequence | frameshift_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | K09C8.1.1:c.2105del | |||||||
HGVSp | CE31034:p.Ala702AspfsTer7 | |||||||
cDNA_position | 2105 | |||||||
CDS_position | 2105 | |||||||
Protein_position | 702 | |||||||
Exon_number | 13/16 | |||||||
Codon_change | gCa/ga | |||||||
Amino_acid_change | A/X | |||||||
Isolation | Mutagen | DEB | ||||||
Genetics | Interpolated_map_position | X | 2.72338 | |||||
Description | Phenotype | WBPhenotype:0000157 | Person_evidence | WBPerson3792 | ||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson3792 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Genotype | pbo-4(ox10)X | Person_evidence | WBPerson3792 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001641 | Paper_evidence | WBPaper00031426 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00031426 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00031426 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | The presence or absence of each muscle contraction was scored for 11 defecation cycles in day 1 adults (n 6). | Paper_evidence | WBPaper00031426 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00031426 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000996 | Paper_evidence | WBPaper00031426 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | The presence or absence of each muscle contraction was scored for 11 defecation cycles in day 1 adults (n 6). | Paper_evidence | WBPaper00031426 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031426 | |||||||
Remark | Deletion of nucleotide 2127(c) and results in early stop following 5 missense amino acids | Person_evidence | WBPerson3792 | |||||
Method | Deletion_allele |