WormBase Tree Display for Variation: WBVar00094770
expand all nodes | collapse all nodes | view schema
WBVar00094770 | Evidence | Paper_evidence | WBPaper00029347 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | os66 | ||||||
Other_name | C37A2.4b.1:c.692_693delinsAA | |||||||
CE33761:p.Trp231Ter | ||||||||
CE24832:p.Trp234Ter | ||||||||
C37A2.4a.1:c.701_702delinsAA | ||||||||
HGVSg | CHROMOSOME_I:g.6782646_6782647delinsAA | |||||||
Sequence_details | SMap | S_parent | Sequence | C37A2 | ||||
Flanking_sequences | gcgatggaataggatcaccaacaaaagttt | tctcttatggtcaaacgagacgaaattcca | ||||||
Mapping_target | C37A2 | |||||||
Type_of_mutation | Substitution | gg | rr | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | HS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000871 | ||||||
Transcript | C37A2.4a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C37A2.4a.1:c.701_702delinsAA | |||||||
HGVSp | CE24832:p.Trp234Ter | |||||||
cDNA_position | 716-717 | |||||||
CDS_position | 701-702 | |||||||
Protein_position | 234 | |||||||
Exon_number | 6/10 | |||||||
Codon_change | tGG/tAA | |||||||
Amino_acid_change | W/* | |||||||
C37A2.4b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C37A2.4b.1:c.692_693delinsAA | |||||||
HGVSp | CE33761:p.Trp231Ter | |||||||
cDNA_position | 714-715 | |||||||
CDS_position | 692-693 | |||||||
Protein_position | 231 | |||||||
Exon_number | 6/10 | |||||||
Codon_change | tGG/tAA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000502904 | |||||||
Genetics | Interpolated_map_position | I | 1.31713 | |||||
Description | Phenotype | WBPhenotype:0000166 | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | In cye-1 mutants, some of the posterior daughters of the seam cells abnormally adopted syncytial fates in the early larval stages. | Paper_evidence | WBPaper00029347 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | ajm-1::gfp | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001923 | Paper_evidence | WBPaper00029347 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | ajm-1::gfp | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001927 | Paper_evidence | WBPaper00029347 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Incomplete | 32 percent showed the phenotype. | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | lag-2::GFP | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001928 | Paper_evidence | WBPaper00029347 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Incomplete | 30 percent showed the phenotype. | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00029347 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000871 Amber_UAG_or_Opal_UGA | |||||||
Method | Substitution_allele |