WormBase Tree Display for Variation: WBVar00094621
expand all nodes | collapse all nodes | view schema
WBVar00094621 | Evidence | Paper_evidence | WBPaper00004137 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | om96 | |||||||
Other_name | CE27140:p.His139Leu | ||||||||
F26A3.3.1:c.416A>T | |||||||||
HGVSg | CHROMOSOME_I:g.7655770T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F26A3 | |||||
Flanking_sequences | ctaacgtcatcccagaaagacacttcccaa | gattaatgaatgttccgccttgaatatttc | |||||||
Mapping_target | F26A3 | ||||||||
Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | EL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001214 | |||||||
Transcript | F26A3.3.1 (12) | ||||||||
Genetics | Interpolated_map_position | I | 2.21486 | ||||||
Description | Phenotype | WBPhenotype:0000812 | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Intersexual germ cells were only observed when the germ line switched from spermatogenesis to oogenesis | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001260 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants typically produced small oocytes with unusual chromosome morphology | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001694 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The spermatogenesis-to-oogenesis switch occurred several hours later in ego-1 mutants than in controls | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001945 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Mutants typically produced small oocytes with unusual chromosome morphology | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Reference | WBPaper00004137 | ||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||||
Method | Substitution_allele |