WormBase Tree Display for Variation: WBVar00094620
expand all nodes | collapse all nodes | view schema
WBVar00094620 | Evidence | Paper_evidence | WBPaper00004137 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | om84 | |||||||
Other_name | F26A3.3.1:c.828_1034del | ||||||||
CE27140:p.Leu276_Tyr345delinsPhe | |||||||||
HGVSg | CHROMOSOME_I:g.7654980_7655231del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F26A3 | |||||
Flanking_sequences | gcactccgtcccacattatcgaagatattt | taaccgttggacattcctaaataatcaaca | |||||||
Mapping_target | F26A3 | ||||||||
Type_of_mutation | Insertion | ||||||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007150 | ||||||||
WBStrain00030624 | |||||||||
Laboratory | EL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001214 | |||||||
Transcript | F26A3.3.1 (11) | ||||||||
Interactor | WBInteraction000502124 | ||||||||
WBInteraction000502125 | |||||||||
Genetics | Interpolated_map_position | I | 2.21436 | ||||||
Description | Phenotype | WBPhenotype:0000666 | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Small oocytes were slow to be ovulated | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035228 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PGL-1 staining in the germline differs from wild type; PGL-1 accumulates in large granules and dissociated from nuclei periphery. | Paper_evidence | WBPaper00035228 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000812 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Intersexual germ cells were only observed when the germ line switched from spermatogenesis to oogenesis | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001260 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants typically produced small oocytes with unusual chromosome morphology | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001694 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The spermatogenesis-to-oogenesis switch occurred several hours later in ego-1 mutants than in controls | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001945 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Small oocytes were slow to be ovulated | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | These proteins are not required for piRNA expression, as determined by comparable levels of 21U-RNA on Northern blot and or qRT-PCR to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00035228 | ||||||||
WBPaper00004137 | |||||||||
WBPaper00031962 | |||||||||
WBPaper00023654 | |||||||||
WBPaper00011141 | |||||||||
WBPaper00015554 | |||||||||
Method | Deletion_and_insertion_allele |