WormBase Tree Display for Variation: WBVar00093798
expand all nodes | collapse all nodes | view schema
WBVar00093798 | Name | Public_name | ok2694 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y42A5A.4b.1:c.848-17_1341del | ||||||||
Y42A5A.4a.1:c.455-17_948del | |||||||||
Y42A5A.4c.1:c.545-17_1038del | |||||||||
HGVSg | CHROMOSOME_V:g.11106516_11107162del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y42A5A | |||||
Flanking_sequences | catactagttcataccagtcaaattgaaat | ggaaattcgaacaatttggtttcaaaaaat | |||||||
Mapping_target | Y42A5A | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok2694_external | ||||||||
ok2694_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032720 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00012779 | |||||||
Transcript | Y42A5A.4c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y42A5A.4c.1:c.545-17_1038del | ||||||||
cDNA_position | ?-1038 | ||||||||
CDS_position | ?-1038 | ||||||||
Protein_position | ?-346 | ||||||||
Intron_number | 4-7/7 | ||||||||
Exon_number | 5-8/8 | ||||||||
Y42A5A.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y42A5A.4a.1:c.455-17_948del | ||||||||
cDNA_position | ?-948 | ||||||||
CDS_position | ?-948 | ||||||||
Protein_position | ?-316 | ||||||||
Intron_number | 3-6/7 | ||||||||
Exon_number | 4-7/8 | ||||||||
Y42A5A.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y42A5A.4b.1:c.848-17_1341del | ||||||||
cDNA_position | ?-1423 | ||||||||
CDS_position | ?-1341 | ||||||||
Protein_position | ?-447 | ||||||||
Intron_number | 7-10/11 | ||||||||
Exon_number | 8-11/12 | ||||||||
Interactor | WBInteraction000579024 | ||||||||
WBInteraction000579026 | |||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0000615 | Paper_evidence | WBPaper00064313 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | "While a subset of rod-like cilia containing well-defined ciliary middle segments is markedly elongated in cdkl-1 mutants (Canning et al., 2018; Park et al., 2021), the overall lengths of the rod-like cilia of the ASH neurons are more weakly affected in this mutant background with a broader distribution of cilia lengths as reported previously (Park et al., 2021) (Figure 1A-B)." "The morphology of the AWA cilia that lack clearly demarcated middle and distal ciliary segments was also only weakly affected in cdkl-1 mutants (Figure 1C-D)..." | Paper_evidence | WBPaper00064313 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00064313 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00064313 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | cdkl-1(ok2694); Ex[sra-6p::myr-gfp; unc-122p::mCherry] and oyIs87[gpa-46p::myr-gfp]; cdkl-1(ok2694) | Paper_evidence | WBPaper00064313 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00064313 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |