WormBase Tree Display for Variation: WBVar00093055

WBVar00093055 Evidence: Paper_evidence: WBPaper00036195
  Name: Public_name: ok1858
    Other_name: F40F4.5.1:c.242-383_954+156delinsTT
    HGVSg: CHROMOSOME_X:g.3253944_3255284delinsTT
  Sequence_details: SMap: S_parent: Sequence: F40F4
    Flanking_sequences: aaaatgcgggaggttagacgcagacttttc tttttattccgtttcaaaatgtggtctcac
    Mapping_target: F40F4
    Type_of_mutation: Insertion: TT
      Deletion
    PCR_product: OK1858_external
      OK1858_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032241
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00006535
    Transcript: F40F4.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F40F4.5.1:c.242-383_954+156delinsTT
        Intron_number: 4-7/10
        Exon_number: 5-7/11
    Interactor: WBInteraction000504818
      WBInteraction000517519
      WBInteraction000517520
      WBInteraction000517521
      WBInteraction000517524
      WBInteraction000517525
      WBInteraction000517526
      WBInteraction000517527
      WBInteraction000517528
      WBInteraction000517530
  Isolation: Mutagen: EMS
  Description: Phenotype: WBPhenotype:0000641 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: These animals also exhibited a hyperexploratory phenotype: in exploratory behavior assays, these animals consistently moved throughmore areas of the plate than wild-type controls (data not shown). Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0000664 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: tba-9 hermaphrodites and males displayed increases in body bend frequency and flex, a measurement of bending angle(data not shown). Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0000961 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: In wild-type males, TRP-4::GFP accumulated in cilia; in mutants, ciliary localization was still present but TRP-4 existed in notably larger punctae. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006972 PATO:0000460 Paper_evidence: WBPaper00036195
                Curator_confirmed: WBPerson712
      WBPhenotype:0001221 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: A significant reduction was observed in the response of mutants to nose touch when compared to wild-type controls. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Uptake of the dye DiD by amphid and phasmid neurons was not grossly compromised; however, the ASI amphid neuron sometimes failed to fill with dye. Similar results were obtained when the IL2 neurons were labeled with DiO in the presence of calcium acetate. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0004006 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Mutant males responded with a frequency of 60%. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0004017 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: tba-9 hermaphrodites and males displayed increases in body bend frequency and flex, a measurement of bending angle(data not shown). Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000649 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Males that responded to contact were able to locate the hermaphrodite vulva with wild-type efficiency and mate successfully. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: We detected no apparent mislocalization of TBB-4::YFP in tba-9 mutants (data not shown). However, In wild-type males, TRP-4::GFP accumulated in cilia; in mutants, ciliary localization was still present. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0001462 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: No differences were observed in the response of mutants using a four-quadrant salt chemotaxis assay compared to wild-type controls. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0001470 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Mutants all responded robustly to the AWA-sensed odorant diacetyl (data not shown). Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
  Reference: WBPaper00036195
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele