WormBase Tree Display for Variation: WBVar00092938
expand all nodes | collapse all nodes | view schema
WBVar00092938 | Name | Public_name | ok1735 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE49843:p.Thr35_Ter300delinsSerLeu | ||||||
K04G2.5b.1:c.103_900delinsTCTCTA | |||||||
K04G2.5a.4:c.-141_657delinsTCTCTA | |||||||
K04G2.5a.1:c.-141_657delinsTCTCTA | |||||||
K04G2.5a.3:c.-141_657delinsTCTCTA | |||||||
HGVSg | CHROMOSOME_I:g.8037199_8039137delinsTAGAGA | ||||||
Sequence_details | SMap | S_parent | Sequence | K04G2 | |||
Flanking_sequences | GAATGAATTGAATATTTAGTGGGCAATGTG | ctgtgtagagacggcagaagttacaataac | |||||
Mapping_target | K04G2 | ||||||
Type_of_mutation | Insertion | TAGAGA | |||||
Deletion | |||||||
PCR_product | ok1735_external | ||||||
ok1735_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032181 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00010564 | |||||
Transcript | K04G2.5a.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | K04G2.5a.4:c.-141_657delinsTCTCTA | ||||||
cDNA_position | 119-916 | ||||||
CDS_position | ?-657 | ||||||
Protein_position | ?-219 | ||||||
Intron_number | 2-6/7 | ||||||
Exon_number | 2-7/8 | ||||||
K04G2.5b.1 (11) | |||||||
K04G2.5a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-728 | ||||||
CDS_position | ?-657 | ||||||
Protein_position | ?-219 | ||||||
Intron_number | 2-4/5 | ||||||
Exon_number | 1-5/6 | ||||||
K04G2.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | K04G2.5a.1:c.-141_657delinsTCTCTA | ||||||
cDNA_position | 45-842 | ||||||
CDS_position | ?-657 | ||||||
Protein_position | ?-219 | ||||||
Intron_number | 1-5/6 | ||||||
Exon_number | 1-6/7 | ||||||
K04G2.5a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | K04G2.5a.3:c.-141_657delinsTCTCTA | ||||||
cDNA_position | 536-1333 | ||||||
CDS_position | ?-657 | ||||||
Protein_position | ?-219 | ||||||
Intron_number | 2-6/7 | ||||||
Exon_number | 2-7/8 | ||||||
Isolation | Mutagen | EMS | |||||
Genetics | Mapping_data | In_multi_point | 5616 | ||||
Description | Phenotype | WBPhenotype:0000039 | Paper_evidence | WBPaper00045834 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | ath-1(ok1735) mutants showed decreased time to 90% mortality (Table 2, Figure 4A) | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 12 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Animals did not show a significant difference in age-related decline of thrashing rate, compared to wild type (N2) controls (Additional file 9) | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Figure 3 A-B | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001726 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for ath-1(ok1735) showed no significant changes in body length or width. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001727 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for ath-1(ok1735) showed no significant changes in body length or width. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 8 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00045834 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |