WormBase Tree Display for Variation: WBVar00092617
expand all nodes | collapse all nodes | view schema
WBVar00092617 | Evidence | Paper_evidence | WBPaper00028496 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok1402 | |||||
Other_name | CE20163:p.Tyr246_Ter429delextTer? | ||||||
W07A12.7.1:c.736_1287del | |||||||
HGVSg | CHROMOSOME_II:g.9162359_9163073del | ||||||
Sequence_details | SMap | S_parent | Sequence | W07A12 | |||
Flanking_sequences | tccacaccaacttgcatgggatatctttgg | cttgccaagctcacctacaacgcgtatctc | |||||
Mapping_target | W07A12 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK1402_external | ||||||
OK1402_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031996 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00012324 | |||||
Transcript | W07A12.7.1 (11) | ||||||
Interactor | WBInteraction000502641 | ||||||
Genetics | Mapping_data | In_multi_point | 5195 | ||||
Description | Phenotype | WBPhenotype:0001014 | Paper_evidence | WBPaper00037627 | |||
Curator_confirmed | WBPerson7196 | ||||||
WBPhenotype:0002060 | Paper_evidence | WBPaper00035580 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | "We also tested rhy-1(ok161) [sic] mutant animals on Cry21A PFT... Animals lacking RHY-1 are also resistant to Cry21A (Table 1; Figure S2). Based on LC50 values, animals lacking RHY-1 are 5.76 resistant to Cry21A PFT (Table 1)." | Paper_evidence | WBPaper00035580 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00028496 | ||||||
WBPaper00035580 | |||||||
WBPaper00037627 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |