WormBase Tree Display for Variation: WBVar00092488
expand all nodes | collapse all nodes | view schema
WBVar00092488 | Name | Public_name | ok1240 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | ZC504.2.2:c.412-25_1151-21del | |||||||
ZC504.2.1:c.412-25_1151-21del | ||||||||
HGVSg | CHROMOSOME_X:g.10414558_10415766del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC504 | ||||
Flanking_sequences | gtaataaaaaaatgtcttgatatttttaat | tgattaattctctctctcagatatcgggcc | ||||||
Mapping_target | ZC504 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1240_external | |||||||
OK1240_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031896 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects (3) | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4886 | |||||
Description | Phenotype | WBPhenotype:0001203 | Paper_evidence | WBPaper00034730 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants of acr-8(ok1240) showed a significant resistance to nicotine in paralysis assays | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000421 | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants of acr-8(ok1240) showed no levamisole resistance | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00034730 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00041959 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000681 | Paper_evidence | WBPaper00027611 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Scored as DMPP sensitive. | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00035548 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are superficially wild-type. | Paper_evidence | WBPaper00035548 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | PSCs for ACh, levamisole, or nicotine did not differ between wild type and acr-8(ok1240) | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001468 | Paper_evidence | WBPaper00041959 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutant worms exhibited a normal approach to a benzaldehyde stimulus. | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms placed on chemotaxis plates spotted with 0.01% benzaldehyde. | Paper_evidence | WBPaper00041959 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00041959 | |||||||
WBPaper00027611 | ||||||||
WBPaper00035548 | ||||||||
WBPaper00034730 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |