WormBase Tree Display for Variation: WBVar00092214
expand all nodes | collapse all nodes | view schema
WBVar00092214 | Name | Public_name | ok943 | ||||
---|---|---|---|---|---|---|---|
Other_name | C43E11.6b.1:c.560-69_1333del | ||||||
C43E11.6a.1:c.1040-69_1813del | |||||||
C43E11.6e.2:c.458-69_1231del | |||||||
C43E11.6e.3:c.458-69_1231del | |||||||
C43E11.6a.3:c.1040-69_1813del | |||||||
C43E11.6b.2:c.560-69_1333del | |||||||
C43E11.6c.1:c.*1050-69_*1823del | |||||||
C43E11.6d.1:c.851-69_1624del | |||||||
C43E11.6a.2:c.1040-69_1813del | |||||||
C43E11.6e.1:c.458-69_1231del | |||||||
HGVSg | CHROMOSOME_I:g.4233817_4234848del | ||||||
Sequence_details | SMap | S_parent | Sequence | C43E11 | |||
Flanking_sequences | tacaccatattccgcgcaagcgtagagaaa | gcaaacttctgttcccactccgaaagaagt | |||||
Mapping_target | C43E11 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok943_external | ||||||
ok943_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031725 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00003516 | |||||
Transcript | C43E11.6e.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6e.2:c.458-69_1231del | ||||||
cDNA_position | ?-1627 | ||||||
CDS_position | ?-1231 | ||||||
Protein_position | ?-411 | ||||||
Intron_number | 6-7/9 | ||||||
Exon_number | 7-8/10 | ||||||
C43E11.6a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6a.2:c.1040-69_1813del | ||||||
cDNA_position | ?-1840 | ||||||
CDS_position | ?-1813 | ||||||
Protein_position | ?-605 | ||||||
Intron_number | 8-9/11 | ||||||
Exon_number | 9-10/12 | ||||||
C43E11.6e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6e.1:c.458-69_1231del | ||||||
cDNA_position | ?-1435 | ||||||
CDS_position | ?-1231 | ||||||
Protein_position | ?-411 | ||||||
Intron_number | 5-6/8 | ||||||
Exon_number | 6-7/9 | ||||||
C43E11.6d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6d.1:c.851-69_1624del | ||||||
cDNA_position | ?-1743 | ||||||
CDS_position | ?-1624 | ||||||
Protein_position | ?-542 | ||||||
Intron_number | 8-9/11 | ||||||
Exon_number | 9-10/12 | ||||||
C43E11.6a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6a.3:c.1040-69_1813del | ||||||
cDNA_position | ?-1842 | ||||||
CDS_position | ?-1813 | ||||||
Protein_position | ?-605 | ||||||
Intron_number | 8-9/12 | ||||||
Exon_number | 9-10/13 | ||||||
C43E11.6b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6b.1:c.560-69_1333del | ||||||
cDNA_position | ?-1459 | ||||||
CDS_position | ?-1333 | ||||||
Protein_position | ?-445 | ||||||
Intron_number | 6-7/9 | ||||||
Exon_number | 7-8/10 | ||||||
C43E11.6b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6b.2:c.560-69_1333del | ||||||
cDNA_position | ?-1362 | ||||||
CDS_position | ?-1333 | ||||||
Protein_position | ?-445 | ||||||
Intron_number | 5-6/8 | ||||||
Exon_number | 6-7/9 | ||||||
C43E11.6a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6a.1:c.1040-69_1813del | ||||||
cDNA_position | ?-1932 | ||||||
CDS_position | ?-1813 | ||||||
Protein_position | ?-605 | ||||||
Intron_number | 9-10/12 | ||||||
Exon_number | 10-11/13 | ||||||
C43E11.6c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6c.1:c.*1050-69_*1823del | ||||||
cDNA_position | ?-2125 | ||||||
Intron_number | 8-9/10 | ||||||
Exon_number | 9-10/11 | ||||||
C43E11.6e.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C43E11.6e.3:c.458-69_1231del | ||||||
cDNA_position | ?-1358 | ||||||
CDS_position | ?-1231 | ||||||
Protein_position | ?-411 | ||||||
Intron_number | 4-5/7 | ||||||
Exon_number | 5-6/8 | ||||||
Interactor | WBInteraction000517452 | ||||||
WBInteraction000517453 | |||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype | WBPhenotype:0002232 | Paper_evidence | WBPaper00028874 | |||
Curator_confirmed | WBPerson4787 | ||||||
Remark | synaptic remodeling defect. fail to remove synapses | Paper_evidence | WBPaper00028874 | ||||
Curator_confirmed | WBPerson4787 | ||||||
Phenotype_not_observed | WBPhenotype:0000616 | Paper_evidence | WBPaper00028874 | ||||
Curator_confirmed | WBPerson4787 | ||||||
Remark | normal synapse morphology | Paper_evidence | WBPaper00028874 | ||||
Curator_confirmed | WBPerson4787 | ||||||
Reference | WBPaper00028874 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |