WormBase Tree Display for Variation: WBVar00092161
expand all nodes | collapse all nodes | view schema
WBVar00092161 | Name | Public_name | ok886 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y81G3A.3b.1:c.2444_3571del | |||||||
CE47938:p.Cys815_Pro1191delinsSer | ||||||||
Y81G3A.3a.1:c.2444_3571del | ||||||||
CE47891:p.Cys815_Pro1191delinsSer | ||||||||
HGVSg | CHROMOSOME_II:g.13086950_13088128del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y81G3A | ||||
Flanking_sequences | aagtttggagaatcttttcggaagttttgt | ccggaatgaagtttactctgaaaatcgggc | ||||||
Mapping_target | Y81G3A | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok886_external | |||||||
ok886_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031690 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00013591 | ||||||
Transcript | Y81G3A.3b.1 (11) | |||||||
Y81G3A.3a.1 (11) | ||||||||
Interactor | WBInteraction000536842 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... However, unlike for TmP, gcn-2(ok871) completely blocked HP (Fig. 4C). gcn-2(ok886), an allele with a smaller deletion that removes less of the kinase and tRNA-binding domains (Fig. 3E), also failed to exhibit a significant increase in survival after HP, although there was a trend toward protection (Fig. 4C)." | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001349 | Paper_evidence | WBPaper00048983 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To evaluate whether either GCN-2 or PEK-1 kinases are required for H2S-dependent phosphorylation of eIF2α, we introduced gcn-2(ok886) or pek-1(ok275) deletion alleles into sqrd-1(tm3378) mutant animals. When exposed to H2S, we observed robust phosphorylation of eIF2α in both pek-1; sqrd-1 and gcn-2; sqrd-1 double mutant animals (Fig. 3, A and B)." | Paper_evidence | WBPaper00048983 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004296 | Paper_evidence | WBPaper00048983 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00037064 | |||||||
WBPaper00048983 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |