WormBase Tree Display for Variation: WBVar00092069
expand all nodes | collapse all nodes | view schema
WBVar00092069 | Name | Public_name | ok789 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F25G6.3.1:c.492+8_988-4del | |||||||
HGVSg | CHROMOSOME_V:g.8562086_8563167del | |||||||
Sequence_details | SMap | S_parent | Sequence | F25G6 | ||||
Flanking_sequences | acgagcaaaaatgtttctttaaagtaagtt | cagacacgtaacctccttctctattggatt | ||||||
Mapping_target | F25G6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok789_external | |||||||
ok789_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031630 | |||||||
WBStrain00048065 | ||||||||
WBStrain00048067 | ||||||||
WBStrain00048068 | ||||||||
WBStrain00048072 | ||||||||
WBStrain00048080 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000055 | ||||||
Transcript | F25G6.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F25G6.3.1:c.492+8_988-4del | |||||||
Intron_number | 4-9/11 | |||||||
Exon_number | 5-9/12 | |||||||
Interactor | WBInteraction000501251 | |||||||
WBInteraction000501252 | ||||||||
WBInteraction000518502 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | ||||
Curator_confirmed | WBPerson8126 | |||||||
Remark | Fig.6 (lifespan extension upon reserpine treatment, not different from wild type) | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | |||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | ||||
Curator_confirmed | WBPerson8126 | |||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | acr-16 mutants show largely reduced peak currents in response to sustained release of ACh, compared to wild-type | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | ACh and nicotine-evoked PSCs were significantly reduced in acr-16 mutants | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001852 | Paper_evidence | WBPaper00035074 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants are susceptible to tribendimidine | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000421 | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | acr-16 mutants are not resistant to levamisole | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00034730 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00041959 | ||||||
WBPaper00046043 | ||||||||
Curator_confirmed | WBPerson557 | |||||||
WBPerson28327 | ||||||||
WBPhenotype:0000681 | Paper_evidence | WBPaper00027611 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Scored as DMPP sensitive. | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00035548 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are superficially wild-type. | Paper_evidence | WBPaper00035548 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001203 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | acr-16 mutants are not resistant to nicotine | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001468 | Paper_evidence | WBPaper00041959 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutant worms exhibited a normal approach to a benzaldehyde stimulus. | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms placed on chemotaxis plates spotted with 0.01% benzaldehyde. | Paper_evidence | WBPaper00041959 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00032995 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No obvious swimming defects in mutants | Paper_evidence | WBPaper00032995 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Disease_info | Models_disease | DOID:0050742 | ||||||
Models_disease_in_annotation | WBDOannot00000676 | |||||||
Reference (11) | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |