WormBase Tree Display for Variation: WBVar00092065
expand all nodes | collapse all nodes | view schema
WBVar00092065 | Name | Public_name | ok785 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | ZK994.3.1:c.1416_2280del | |||||||
CE40298:p.Asp473GlufsTer2 | ||||||||
HGVSg | CHROMOSOME_V:g.8497619_8498702del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK994 | ||||
Flanking_sequences | agagcttcgtatatcaaatattgaaaagaa | agagtgaagagtggaaggtgagaatgctaa | ||||||
Mapping_target | ZK994 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok785_external | |||||||
ok785_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031626 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004256 | ||||||
Transcript | ZK994.3.1 (11) | |||||||
Interactor | WBInteraction000537480 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000518 | Paper_evidence | WBPaper00037647 | ||||
Curator_confirmed | WBPerson10095 | |||||||
Remark | partially suppressed lethal, morphological and egg-laying defects of multiple pxn-2 alleles | Paper_evidence | WBPaper00037647 | |||||
Curator_confirmed | WBPerson10095 | |||||||
Recessive | Paper_evidence | WBPaper00037647 | ||||||
Curator_confirmed | WBPerson10095 | |||||||
Phenotype_assay | Genotype | pxn-2(-) | Paper_evidence | WBPaper00037647 | ||||
Curator_confirmed | WBPerson10095 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00037647 | ||||||
Curator_confirmed | WBPerson10095 | |||||||
Remark | partially suppressed lethal, morphological and egg-laying defects of multiple pxn-2 alleles | Paper_evidence | WBPaper00037647 | |||||
Curator_confirmed | WBPerson10095 | |||||||
Recessive | Paper_evidence | WBPaper00037647 | ||||||
Curator_confirmed | WBPerson10095 | |||||||
Phenotype_assay | Genotype | pxn-2(-) | Paper_evidence | WBPaper00037647 | ||||
Curator_confirmed | WBPerson10095 | |||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00037647 | ||||||
Curator_confirmed | WBPerson10095 | |||||||
Remark | partially suppressed lethal, morphological and egg-laying defects of multiple pxn-2 alleles | Paper_evidence | WBPaper00037647 | |||||
Curator_confirmed | WBPerson10095 | |||||||
Recessive | Paper_evidence | WBPaper00037647 | ||||||
Curator_confirmed | WBPerson10095 | |||||||
Phenotype_assay | Genotype | pxn-2(-) | Paper_evidence | WBPaper00037647 | ||||
Curator_confirmed | WBPerson10095 | |||||||
Reference | WBPaper00037647 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |