WormBase Tree Display for Variation: WBVar00092052
expand all nodes | collapse all nodes | view schema
WBVar00092052 | Name | Public_name | ok772 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C11D9.1.1:c.1824+37_2226+12delinsCTGTAACTTAACTGTAAC | ||||||||
HGVSg | CHROMOSOME_I:g.4424394_4425231delinsCTGTAACTTAACTGTAAC | ||||||||
Sequence_details | SMap | S_parent | Sequence | C41D11 | |||||
Flanking_sequences | ttctttagaaaaaggctatctgtaacttaa | tttgctcaagcggtcatatacgaaaatggt | |||||||
Mapping_target | C41D11 | ||||||||
Type_of_mutation | Insertion | CTGTAACTTAACTGTAAC | |||||||
Deletion | |||||||||
PCR_product | ok772_external | ||||||||
ok772_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00024145 | ||||||||
WBStrain00024146 | |||||||||
WBStrain00024156 | |||||||||
WBStrain00024172 | |||||||||
WBStrain00024173 | |||||||||
WBStrain00031619 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015704 | |||||||
Transcript | C11D9.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C11D9.1.1:c.1824+37_2226+12delinsCTGTAACTTAACTGTAAC | ||||||||
Intron_number | 15-16/19 | ||||||||
Exon_number | 16/20 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000944 | Paper_evidence | WBPaper00049729 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | Figure 2. PLM posterior neurite was shortened and PLM anterior neurite overextended. | Paper_evidence | WBPaper00049729 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00049729 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
GO_term | GO:0043005 | PATO:0000460 | Paper_evidence | WBPaper00049729 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
Phenotype_not_observed | WBPhenotype:0001413 | Paper_evidence | WBPaper00040813 | ||||||
Curator_confirmed | WBPerson2706 | ||||||||
Reference | WBPaper00040813 | ||||||||
WBPaper00049729 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |