WormBase Tree Display for Variation: WBVar00091780
expand all nodes | collapse all nodes | view schema
| WBVar00091780 | Name | Public_name | ok492 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | C07H6.5.1:c.510_*66delinsG | ||||||||
| HGVSg | CHROMOSOME_III:g.7496196_7497238delinsC | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C07H6 | |||||
| Flanking_sequences | gagaacatacacaatctggacgagatcact | cctggggtggcgatgaccaagtgaaccgtt | |||||||
| Mapping_target | C07H6 | ||||||||
| Type_of_mutation | Insertion | C | |||||||
| Deletion | |||||||||
| PCR_product | ok492_external | ||||||||
| ok492_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00005662 | ||||||||
| WBStrain00036702 | |||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00044945 | |||||||
| WBGene00000479 | |||||||||
| Transcript | C07H6.10 | VEP_consequence | transcript_ablation | ||||||
| VEP_impact | HIGH | ||||||||
| Exon_number | 1/1 | ||||||||
| C07H6.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C07H6.5.1:c.510_*66delinsG | ||||||||
| cDNA_position | 548-1397 | ||||||||
| CDS_position | 510-? | ||||||||
| Protein_position | 170-? | ||||||||
| Intron_number | 3-4/5 | ||||||||
| Exon_number | 3-6/6 | ||||||||
| Interactor | WBInteraction000051406 | ||||||||
| WBInteraction000051409 | |||||||||
| WBInteraction000503743 | |||||||||
| WBInteraction000503744 | |||||||||
| WBInteraction000503745 | |||||||||
| WBInteraction000503746 | |||||||||
| WBInteraction000503747 | |||||||||
| WBInteraction000503748 | |||||||||
| Isolation | Mutagen | UV/TMP | |||||||
| Genetics | Mapping_data | In_multi_point | 4214 | ||||||
| Description | Phenotype | WBPhenotype:0000438 | Paper_evidence | WBPaper00032974 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | cgh-1(0) homozygotes (derived from heterozygous mothers) exhibit mild heterochronic phenotypes | Paper_evidence | WBPaper00032974 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00032974 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000688 | Paper_evidence | WBPaper00040966 | |||||||
| Curator_confirmed | WBPerson9063 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00026922 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | GFP-LAP:CAR-1 localization severely abnormal in the rachis. | Paper_evidence | WBPaper00026922 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002259 | Paper_evidence | WBPaper00046432 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutants exhibit fewer dendritic termini and significantly more secondary and tertiary branches than controls. | Paper_evidence | WBPaper00046432 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00046432 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| GO_term | GO:0044292 | PATO:0001997 | Paper_evidence | WBPaper00046432 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00040966 | ||||||||
| WBPaper00026922 | |||||||||
| WBPaper00032974 | |||||||||
| WBPaper00010802 | |||||||||
| WBPaper00012537 | |||||||||
| WBPaper00025636 | |||||||||
| WBPaper00018760 | |||||||||
| WBPaper00046432 | |||||||||
| WBPaper00065825 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
