WormBase Tree Display for Variation: WBVar00091664
expand all nodes | collapse all nodes | view schema
WBVar00091664 | Name | Public_name | ok367 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | R01E6.4a.1:c.592+19_1356+5del | |||||||
R01E6.4b.1:c.319+19_1083+5del | ||||||||
HGVSg | CHROMOSOME_X:g.13534147_13535514del | |||||||
Sequence_details | SMap | S_parent | Sequence | R01E6 | ||||
Flanking_sequences | aacttccacaaggtaaattcagctgggctg | tagacagtggtttcttaaaaactacaagta | ||||||
Mapping_target | R01E6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK367_external | |||||||
OK367_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035572 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000051 | ||||||
Transcript | R01E6.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | R01E6.4a.1:c.592+19_1356+5del | |||||||
Intron_number | 6-11/13 | |||||||
Exon_number | 7-11/14 | |||||||
R01E6.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R01E6.4b.1:c.319+19_1083+5del | |||||||
Intron_number | 4-9/10 | |||||||
Exon_number | 5-9/11 | |||||||
Interactor | WBInteraction000562870 | |||||||
Genetics | Mapping_data | In_multi_point | 4138 | |||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00042180 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Authors found the acr-12(ok367) mutation accelerated the time course of aldicarb-induced paralysis. Note: Authors showed that specific expression of acr-12 in GABA neurons restored wild-type sensitivity to aldicarb. | Paper_evidence | WBPaper00042180 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Staged populations of adult animals were transferred to nematode growth medium plates containing 1 mM aldicarb and movement was assessed every 15 minutes for 2 hours. | Paper_evidence | WBPaper00042180 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00042180 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | acr-12(ok367) mutations significantly reduced the rate of endogenous excitatory postsynaptic currents (EPSCs), but did not affect EPSC amplitude. When recording outward GABA-mediated inhibitory postsynaptic currents (IPSCs) authors also observed a significant reduction in the rate of inhibitory events (IPSCs), but not a significant difference in the amplitude of endogenous IPSCs. | Paper_evidence | WBPaper00042180 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0002326 | Paper_evidence | WBPaper00042180 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0004018 | Paper_evidence | WBPaper00042180 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | The sinusoidal locomotory wave appeared more erratic in acr-12(ok367) mutants with an increased variability from one body bend to the next. | Paper_evidence | WBPaper00042180 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000681 | Paper_evidence | WBPaper00027611 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Scored as DMPP sensitive. | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00035548 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are superficially wild-type, as are acr-2(n2420); acr-12(ok367) double mutant animals. | Paper_evidence | WBPaper00035548 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001468 | Paper_evidence | WBPaper00041959 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutant worms exhibited a normal approach to a benzaldehyde stimulus. | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms placed on chemotaxis plates spotted with 0.01% benzaldehyde. | Paper_evidence | WBPaper00041959 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00041959 | |||||||
WBPaper00027611 | ||||||||
WBPaper00035548 | ||||||||
WBPaper00026201 | ||||||||
WBPaper00042180 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |