WormBase Tree Display for Variation: WBVar00091509
expand all nodes | collapse all nodes | view schema
WBVar00091509 | Evidence | Paper_evidence | WBPaper00039866 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok200 | |||||||
HGVSg | CHROMOSOME_IV:g.11800544_11801794del | ||||||||
Sequence_details | SMap | S_parent | Sequence | H01G02 | |||||
Flanking_sequences | aaactcacttttgaaacattcgggaccatt | gatgaagatcatggaacgttgcaatcaatt | |||||||
Mapping_target | H01G02 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK200_external | ||||||||
OK200_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007240 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00045108 | |||||||
WBGene00010349 | |||||||||
Transcript | H01G02.4.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | 886-? | ||||||||
Intron_number | 6/6 | ||||||||
Exon_number | 6-7/7 | ||||||||
H01G02.4.1 | VEP_consequence | 3_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 886-? | ||||||||
Exon_number | 6/6 | ||||||||
H01G02.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-206 | ||||||||
CDS_position | ?-116 | ||||||||
Protein_position | ?-39 | ||||||||
Intron_number | 2/8 | ||||||||
Exon_number | 1-3/9 | ||||||||
Interactor | WBInteraction000563598 | ||||||||
WBInteraction000579025 | |||||||||
WBInteraction000579026 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000249 | Paper_evidence | WBPaper00039866 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The strain was impaired in its ability to avoid substances of high osmolarity (Osm phenotype). | Paper_evidence | WBPaper00039866 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000255 | Paper_evidence | WBPaper00054177 | |||||||
Curator_confirmed | WBPerson22262 | ||||||||
Remark | suppression of dye filling defective | Paper_evidence | WBPaper00054177 | ||||||
Curator_confirmed | WBPerson22262 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00039866 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The dyf-18 (ok200) mutant showed prominent accumulations of the homodimeric kinesin-II motor, OSM-3, between the middle and the distal segment both in the amphid and phasmid neuron cilia in 100% of the mutant worms. The IFT protein OSM-5, on the other hand, was frequently observed to accumulate at the base of cilia in amphid and phasmid neurons, with much reduced localization along the ciliary axoneme. | Paper_evidence | WBPaper00039866 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000615 | Paper_evidence | WBPaper00039866 | |||||||
WBPaper00056552 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson35872 | |||||||||
Remark | The structure of most cilia appeared superficially similar to wild type, with occasionally long curved cilia. | Paper_evidence | WBPaper00039866 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
long and unbranched AWA cilia | Paper_evidence | WBPaper00056552 | |||||||
Curator_confirmed | WBPerson35872 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00056552 | ||||
Curator_confirmed | WBPerson35872 | ||||||||
GO_term | GO:0005929 | PATO:0000573 | Paper_evidence | WBPaper00056552 | |||||
Curator_confirmed | WBPerson35872 | ||||||||
PATO:0000414 | Paper_evidence | WBPaper00056552 | |||||||
Curator_confirmed | WBPerson35872 | ||||||||
WBPhenotype:0000854 | Paper_evidence | WBPaper00054177 | |||||||
Curator_confirmed | WBPerson22262 | ||||||||
EQ_annotations | GO_term | GO:0042073 | PATO:0000460 | Paper_evidence | WBPaper00054177 | ||||
Curator_confirmed | WBPerson22262 | ||||||||
WBPhenotype:0002471 | Paper_evidence | WBPaper00056552 | |||||||
Curator_confirmed | WBPerson35872 | ||||||||
Remark | long and unbranched AWA cilia | Paper_evidence | WBPaper00056552 | ||||||
Curator_confirmed | WBPerson35872 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00056552 | ||||
Curator_confirmed | WBPerson35872 | ||||||||
GO_term | GO:0005929 | PATO:0000573 | Paper_evidence | WBPaper00056552 | |||||
Curator_confirmed | WBPerson35872 | ||||||||
PATO:0000414 | Paper_evidence | WBPaper00056552 | |||||||
Curator_confirmed | WBPerson35872 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00039866 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Compared to wild-type animals, ok200 mutant animals display only a weak ability to uptake the dye in amphid (head) and phasmid (tail) neurons. | Paper_evidence | WBPaper00039866 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00039866 | ||||||||
WBPaper00054177 | |||||||||
WBPaper00056552 | |||||||||
WBPaper00065813 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |