WormBase Tree Display for Variation: WBVar00091484
expand all nodes | collapse all nodes | view schema
WBVar00091484 | Evidence | Person_evidence | WBPerson7982 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok161 | ||||||
HGVSg | CHROMOSOME_X:g.11306637_11307938del | |||||||
Sequence_details | SMap | S_parent | Sequence | F08G12 | ||||
Flanking_sequences | ttttgtgtgattttttgcaagctggcgtac | cacctcacttttaactgttaatattttttc | ||||||
Mapping_target | F08G12 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004655 | |||||||
WBStrain00004677 | ||||||||
WBStrain00004678 | ||||||||
WBStrain00040827 | ||||||||
Component_of_genotype | WBGenotype00000008 | |||||||
WBGenotype00000020 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
WBPerson7982 | ||||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006922 | ||||||
Transcript | F08G12.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 1-3/5 | |||||||
Interactor (16) | ||||||||
Description | Phenotype (18) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00031981 | |||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Homozygous viable. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031981 | |||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000497 | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No significant change in embryonic lethality in vhl-1(ok161) mutants compared to wild-type worms after IR | Paper_evidence | WBPaper00036343 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000741 | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | vhl-1(ok161) worms showed a normal cell cycle arrest upon IR, as assessed by the decrease in the number of proliferating cells in the stem cell compartment | Paper_evidence | WBPaper00036343 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001256 | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | vhl-1(ok161) worms showed normal HUS-1 foci formation in the mitotic germline zone post ionizing radiation treatment | Paper_evidence | WBPaper00036343 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00040863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | vhl-1(ok161) mutant animals displayed reduced expression of Pftn-1::GFP in response to 0.1 millimolar 2-2' bipyridyl (BP), similar to wild type animals (Figure 5B). | Paper_evidence | WBPaper00040863 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005433 | Paper_evidence | WBPaper00040863 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | wuIs177 [Pftn-1::GFP] | Paper_evidence | WBPaper00040863 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001861 | Paper_evidence | WBPaper00035435 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | H2S exposure of vhl-1(ok161); nhr-57::gfp(iaIs07) worms results in hypodermal fluorescence similar to that seen in control animals | Paper_evidence | WBPaper00035435 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035435 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00046162 | ||||||
Curator_confirmed | WBPerson2857 | |||||||
Remark | animals develop the same number of polyglutamine aggregates as wild-type when exposed to environments with either 1000 ppm or 5000 ppm oxygen | Paper_evidence | WBPaper00046162 | |||||
Curator_confirmed | WBPerson2857 | |||||||
Disease_info | Models_disease | DOID:4467 | ||||||
DOID:14175 | ||||||||
Models_disease_in_annotation | WBDOannot00000597 | |||||||
WBDOannot00000598 | ||||||||
WBDOannot00000601 | ||||||||
WBDOannot00001276 | ||||||||
Reference | WBPaper00040550 | |||||||
WBPaper00040863 | ||||||||
WBPaper00031981 | ||||||||
WBPaper00035435 | ||||||||
WBPaper00036343 | ||||||||
WBPaper00036195 | ||||||||
WBPaper00035580 | ||||||||
WBPaper00046162 | ||||||||
WBPaper00049131 | ||||||||
WBPaper00055561 | ||||||||
Remark | Last updated on 29 Nov 2002 | |||||||
Generated by the C. elegans Gene Knockout Consortium | ||||||||
Allele sequenced by AC Epstein | Curator_confirmed | WBPerson2970 | ||||||
Method | KO_consortium_allele |