WormBase Tree Display for Variation: WBVar00091396
expand all nodes | collapse all nodes | view schema
WBVar00091396 | Evidence | Paper_evidence | WBPaper00003509 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | nr2073 | |||||||
Other_name | K03E6.1b.1:c.292_925delinsTTATAAA | ||||||||
K03E6.1b.2:c.292_925delinsTTATAAA | |||||||||
CE45007:p.Tyr99_Ter309delinsTer | |||||||||
K03E6.1a.1:c.292_*674delinsTTATAAA | |||||||||
HGVSg | CHROMOSOME_X:g.1077610_1079313delinsTTATAAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | K03E6 | |||||
Flanking_sequences | cagatgtctccaatatgtcaatctttcagg | aaatttattttccatatcactcttgacttt | |||||||
Mapping_target | K03E6 | ||||||||
Type_of_mutation | Insertion | TTATAAA | Paper_evidence | WBPaper00003509 | |||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00002988 | |||||||
Transcript | K03E6.1b.2 (11) | ||||||||
K03E6.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K03E6.1a.1:c.292_*674delinsTTATAAA | ||||||||
cDNA_position | 366-1681 | ||||||||
CDS_position | 292-? | ||||||||
Protein_position | 98-? | ||||||||
Intron_number | 6-8/9 | ||||||||
Exon_number | 6-10/10 | ||||||||
K03E6.1b.1 (11) | |||||||||
Interactor (17) | |||||||||
Genetics | Interpolated_map_position | X | -18.744 | ||||||
Description | Phenotype | WBPhenotype:0001278 | Paper_evidence | WBPaper00049336 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "aptf-1 expression was completely abolished in most individuals and strongly reduced in the remaining ones in all developmental stages (Figure 1C, Figure 1-figure supplement 1A)" | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005045 | PATO:0000460 | Paper_evidence | WBPaper00049336 | ||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Genotype | goeIs118[aptf-1p::SL1::GCaMP3.35::SL2::mKate2::aptf-1 3'UTR; unc-119(+)] | Paper_evidence | WBPaper00049336 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00038390 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Class IV Lsy: ASER fate markers are gained in ASEL but ASEL fate markers are unaffected. | Paper_evidence | WBPaper00038390 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00049336 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "The mutants had strongly reduced or even complete absence of immobility during the non-pumping phase (Figure 1A)" | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00029278 | Paper_evidence | WBPaper00049336 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ASE asymmetry is disrupted (as seen with gcy-5 reporter). Mixed fate in ASEL | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | ntIs1 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001818 | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "RIS activity increased at sleep onset in wild-type animals and also normally increased in lim-6 mutants during the time the animal should enter sleep(Figure 1B)" | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005045 | PATO:0000460 | Paper_evidence | WBPaper00049336 | ||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00029278 | Paper_evidence | WBPaper00049336 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Reference | WBPaper00038390 | ||||||||
WBPaper00006052 | |||||||||
WBPaper00003509 | |||||||||
WBPaper00015696 | |||||||||
WBPaper00049336 | |||||||||
Method | Deletion_and_insertion_allele |