WormBase Tree Display for Variation: WBVar00091277
expand all nodes | collapse all nodes | view schema
| WBVar00091277 | Evidence | Paper_evidence | WBPaper00004727 | ||
|---|---|---|---|---|---|
| Author_evidence | Ikue M | ||||
| Name | Public_name | nj14 | |||
| Sequence_details | SMap | S_parent | Sequence | C40H5 | |
| Flanking_sequences | cgcatgcggacatcatttaaacatcaccag | gctatgaaaacatactttgcccttaaccat | |||
| Mapping_target | C40H5 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | IK | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00006654 | |||
| Transcript | C40H5.5b.1 | ||||
| C40H5.5a.1 | |||||
| Genetics | Interpolated_map_position | X | 6.70812 | ||
| Reference | WBPaper00004727 | ||||
| Remark | nj14 is a mutation caused by Tc1 insertion between codons L (304) and R (305). The flanking sequences are 30 bp to the left and right of L and R codons, respectively [030414 ck1] | ||||
| Method | Transposon_insertion |
