WormBase Tree Display for Variation: WBVar00090963
expand all nodes | collapse all nodes | view schema
WBVar00090963 | Evidence | Paper_evidence | WBPaper00003711 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | K08H10 | |||||
Flanking_sequences | aagtggagcaaaagaatacgctgtaccaatg | aacatcttgaagttcatgagaagccacaaag | |||||||
Mapping_target | K08H10 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003711 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (42) | |||||||||
Laboratory | WM | ||||||||
NR | |||||||||
SHU | |||||||||
VP | |||||||||
MBA | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004323 | |||||||
Transcript | K08H10.7.1 (12) | ||||||||
Genetics | Interpolated_map_position | V | 2.22831 | ||||||
Mapping_data | In_multi_point | 4628 | |||||||
Description | Phenotype | WBPhenotype:0001208 | Paper_evidence | WBPaper00030899 | |||||
WBPaper00003711 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Remark | Animals showed strong resistance to RNAi. | Paper_evidence | WBPaper00003711 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002252 | Paper_evidence | WBPaper00038088 | |||||||
Curator_confirmed | WBPerson172 | ||||||||
Remark | Figure 7 | Paper_evidence | WBPaper00038088 | ||||||
Curator_confirmed | WBPerson172 | ||||||||
Phenotype_not_observed | WBPhenotype:0000745 | Paper_evidence | WBPaper00003711 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00003711 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00035199 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001594 | Paper_evidence | WBPaper00003711 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||||
WBPaper00035199 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Levels of 21U-RNA, from Nothern blot or from qRT-PRC, were comparable to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001769 | Paper_evidence | WBPaper00032049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cytoplasmic-localized RNAs were susceptible to silencing. | Paper_evidence | WBPaper00032049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were fed bacteria expressing dsRNAs. | Paper_evidence | WBPaper00032049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | eri-1(mg366) | Paper_evidence | WBPaper00032049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001776 | Paper_evidence | WBPaper00035199 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals express endo siRNAs. | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001778 | Paper_evidence | WBPaper00032049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Nuclear-localized RNAs were susceptible to silencing. | Paper_evidence | WBPaper00032049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were fed bacteria expressing dsRNAs. | Paper_evidence | WBPaper00032049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | eri-1(mg366) | Paper_evidence | WBPaper00032049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00035199 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002168 | Paper_evidence | WBPaper00045092 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | rde-1 mutants were similar to wildtype animals in terms of fertility at generation 10. | Paper_evidence | WBPaper00045092 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (18) | |||||||||
Method | Substitution_allele |