WormBase Tree Display for Variation: WBVar00090963
expand all nodes | collapse all nodes | view schema
| WBVar00090963 | Evidence | Paper_evidence | WBPaper00003711 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ne219 | |||||||
| Other_name | CE28243:p.Glu414Lys | ||||||||
| K08H10.7.1:c.1240G>A | |||||||||
| HGVSg | CHROMOSOME_V:g.9990087C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | K08H10 | |||||
| Flanking_sequences | aagtggagcaaaagaatacgctgtaccaatg | aacatcttgaagttcatgagaagccacaaag | |||||||
| Mapping_target | K08H10 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003711 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00000186 | ||||||||
| WBStrain00000441 | |||||||||
| WBStrain00022643 | |||||||||
| WBStrain00023352 | |||||||||
| WBStrain00023353 | |||||||||
| WBStrain00028863 | |||||||||
| WBStrain00028867 | |||||||||
| WBStrain00028868 | |||||||||
| WBStrain00029102 | |||||||||
| WBStrain00029103 | |||||||||
| WBStrain00029107 | |||||||||
| WBStrain00031246 | |||||||||
| WBStrain00031316 | |||||||||
| WBStrain00034046 | |||||||||
| WBStrain00034047 | |||||||||
| WBStrain00035053 | |||||||||
| WBStrain00040175 | |||||||||
| WBStrain00040414 | |||||||||
| WBStrain00040415 | |||||||||
| WBStrain00040650 | |||||||||
| WBStrain00040651 | |||||||||
| WBStrain00040653 | |||||||||
| WBStrain00040654 | |||||||||
| WBStrain00047386 | |||||||||
| WBStrain00047708 | |||||||||
| WBStrain00048104 | |||||||||
| WBStrain00048108 | |||||||||
| WBStrain00048110 | |||||||||
| WBStrain00052445 | |||||||||
| WBStrain00052446 | |||||||||
| WBStrain00055665 | |||||||||
| WBStrain00055666 | |||||||||
| WBStrain00055667 | |||||||||
| WBStrain00055668 | |||||||||
| WBStrain00055669 | |||||||||
| WBStrain00057112 | |||||||||
| WBStrain00057316 | |||||||||
| WBStrain00057317 | |||||||||
| WBStrain00057318 | |||||||||
| WBStrain00057326 | |||||||||
| WBStrain00057328 | |||||||||
| WBStrain00057329 | |||||||||
| Laboratory | WM | ||||||||
| NR | |||||||||
| SHU | |||||||||
| VP | |||||||||
| MBA | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00004323 | |||||||
| Transcript | K08H10.7.1 (12) | ||||||||
| Genetics | Interpolated_map_position | V | 2.22831 | ||||||
| Mapping_data | In_multi_point | 4628 | |||||||
| Description | Phenotype | WBPhenotype:0001208 | Paper_evidence | WBPaper00030899 | |||||
| WBPaper00003711 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson557 | |||||||||
| Remark | Animals showed strong resistance to RNAi. | Paper_evidence | WBPaper00003711 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0002252 | Paper_evidence | WBPaper00038088 | |||||||
| Curator_confirmed | WBPerson172 | ||||||||
| Remark | Figure 7 | Paper_evidence | WBPaper00038088 | ||||||
| Curator_confirmed | WBPerson172 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000745 | Paper_evidence | WBPaper00003711 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001175 | Paper_evidence | WBPaper00003711 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001258 | Paper_evidence | WBPaper00035199 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001594 | Paper_evidence | WBPaper00003711 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||||
| WBPaper00035199 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Levels of 21U-RNA, from Nothern blot or from qRT-PRC, were comparable to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001769 | Paper_evidence | WBPaper00032049 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Cytoplasmic-localized RNAs were susceptible to silencing. | Paper_evidence | WBPaper00032049 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were fed bacteria expressing dsRNAs. | Paper_evidence | WBPaper00032049 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | eri-1(mg366) | Paper_evidence | WBPaper00032049 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001776 | Paper_evidence | WBPaper00035199 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals express endo siRNAs. | Paper_evidence | WBPaper00035199 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001778 | Paper_evidence | WBPaper00032049 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Nuclear-localized RNAs were susceptible to silencing. | Paper_evidence | WBPaper00032049 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were fed bacteria expressing dsRNAs. | Paper_evidence | WBPaper00032049 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | eri-1(mg366) | Paper_evidence | WBPaper00032049 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001779 | Paper_evidence | WBPaper00035199 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002168 | Paper_evidence | WBPaper00045092 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | rde-1 mutants were similar to wildtype animals in terms of fertility at generation 10. | Paper_evidence | WBPaper00045092 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (18) | |||||||||
| Method | Substitution_allele |
