WormBase Tree Display for Variation: WBVar00090898
expand all nodes | collapse all nodes | view schema
WBVar00090898 | Evidence | Paper_evidence | WBPaper00031335 | ||
---|---|---|---|---|---|
Name | Public_name | n4797 | |||
HGVSg | CHROMOSOME_X:g.227546_228538del | ||||
Sequence_details | SMap | S_parent | Sequence | AC8 | |
Flanking_sequences | ATCAAAGTGAACAAATACG | GTCTCTCTTTTGTAGTATGAAT | |||
Mapping_target | AC8 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00027530 | ||||
Laboratory | MT | ||||
Status | Live | ||||
Affects | Gene | WBGene00007075 | |||
WBGene00043991 | |||||
Transcript | AC8.13 | ||||
AC8.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | 767-? | ||||
CDS_position | 767-? | ||||
Protein_position | 256-? | ||||
Intron_number | 5-6/6 | ||||
Exon_number | 5-7/7 | ||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00031335 | |
Genetics | Interpolated_map_position | X | -20.3173 | ||
Description | Phenotype_not_observed (7) | ||||
Reference | WBPaper00031335 | ||||
Remark | There are two mir-258 genes, mir-258.1 and mir-258.2, very close to each other at a duplicated region of 10kb on the right end of LGX. Whether the deletion is in mir-258.1 or mir-258.2 has not been resolved. | Paper_evidence | WBPaper00031335 | ||
Method | Deletion_allele |