WormBase Tree Display for Variation: WBVar00090656

WBVar00090656 Evidence: Paper_evidence: WBPaper00002543
  Name: Public_name: n3091
    Other_name: Y71F9B.5a.2:c.163C>T
      CE28810:p.Gln55Ter
      CE25569:p.Gln55Ter
      Y71F9B.5b.1:c.163C>T
      Y71F9B.5a.1:c.163C>T
    HGVSg: CHROMOSOME_I:g.2708198C>T
  Sequence_details: SMap: S_parent: Sequence: Y71F9B
    Flanking_sequences: tatttcccgaataccattctacacaacgat aacacacggtaagcccccttcaccaataat
    Mapping_target: Y71F9B
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00002543
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008495
      WBStrain00027350
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00003006
    Transcript: Y71F9B.5a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y71F9B.5a.1:c.163C>T
        HGVSp: CE25569:p.Gln55Ter
        cDNA_position: 193
        CDS_position: 163
        Protein_position: 55
        Exon_number: 3/11
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      Y71F9B.5b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y71F9B.5b.1:c.163C>T
        HGVSp: CE28810:p.Gln55Ter
        cDNA_position: 194
        CDS_position: 163
        Protein_position: 55
        Exon_number: 3/11
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      Y71F9B.5a.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y71F9B.5a.2:c.163C>T
        HGVSp: CE25569:p.Gln55Ter
        cDNA_position: 490
        CDS_position: 163
        Protein_position: 55
        Exon_number: 4/12
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000500222
      WBInteraction000500223
      WBInteraction000502406
      WBInteraction000502798
      WBInteraction000521878
      WBInteraction000538657
      WBInteraction000538660
      WBInteraction000538734
      WBInteraction000538737
  Genetics: Interpolated_map_position: I -7.43257
  Description: Phenotype (10)
    Phenotype_not_observed: WBPhenotype:0000232 Paper_evidence: WBPaper00024898
        Curator_confirmed: WBPerson2987
        Remark: Table 1 Paper_evidence: WBPaper00024898
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0006827 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          GO_term: GO:0016477 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: From Table 1 legend: "A CAN was scored as defective if its nucleus was anterior to the V3 nucleus." Paper_evidence: WBPaper00024898
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000469 Paper_evidence: WBPaper00024898
        Curator_confirmed: WBPerson2987
        Remark: Table 1 Paper_evidence: WBPaper00024898
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0004991 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
            WBbt:0003832 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          GO_term: GO:0016477 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: From Table 1 legend: "Because they occupy positions near each other, the data for SDQR and AVM were combined and are presented in the QR column. SDQR and AVM were scored as defective if their nuclei were posterior to the V2.a nucleus. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." Paper_evidence: WBPaper00024898
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000470 Paper_evidence: WBPaper00024898
        Curator_confirmed: WBPerson2987
        Remark: Table 1 Paper_evidence: WBPaper00024898
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0006830 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          GO_term: GO:0016477 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: From Table 1 legend: "Because the HSNs were sometimes misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. An HSN was scored as misplaced anteriorly if its nucleus was anterior to the P5/6 nucleus and as misplaced posteriorly if its nucleus was posterior to the V4 nucleus." Paper_evidence: WBPaper00024898
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000471 Paper_evidence: WBPaper00024898
        Curator_confirmed: WBPerson2987
        Remark: Table 1 Paper_evidence: WBPaper00024898
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005406 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          GO_term: GO:0016477 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: From the Table 1 legend: "An ALM was scored as defective if its nucleus was anterior to the V2 nucleus." Paper_evidence: WBPaper00024898
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000594 Paper_evidence: WBPaper00024898
        Curator_confirmed: WBPerson2987
        Remark: Table 1 Paper_evidence: WBPaper00024898
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0006826 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
          GO_term: GO:0016477 PATO:0000460 Paper_evidence: WBPaper00024898
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: From Table 1 legend: "Because BDUs sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A BDU was scored as misplaced anteriorly if its nucleus was anterior to its normal position immediately anterior to V1 and misplaced posteriorly if its nucleus was posterior to the V1 nucleus." Paper_evidence: WBPaper00024898
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001660 Paper_evidence: WBPaper00006052
        Curator_confirmed: WBPerson2021
        Remark: No disruption of ASE asymmetry (as seen with lim-6 reporters) Paper_evidence: WBPaper00006052
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: otIs114, otIs6 Paper_evidence: WBPaper00006052
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00004579
    WBPaper00024898
    WBPaper00003428
    WBPaper00006052
    WBPaper00003570
    WBPaper00026860
    WBPaper00002543
  Method: Substitution_allele