WormBase Tree Display for Variation: WBVar00090596
expand all nodes | collapse all nodes | view schema
WBVar00090596 | Evidence | Paper_evidence | WBPaper00005800 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n2845 | |||||||
Other_name | Y50D4C.4a.1:c.2290C>T | ||||||||
CE50722:p.Gln84Ter | |||||||||
CE35919:p.Gln764Ter | |||||||||
Y50D4C.4b.1:c.1156C>T | |||||||||
Y50D4C.4c.1:c.250C>T | |||||||||
CE50778:p.Gln386Ter | |||||||||
HGVSg | CHROMOSOME_V:g.951736G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y50D4C | |||||
Flanking_sequences | aacgcgcattgccacgtggattacctacgc | agttcttcaaaattgccgatttttgcactt | |||||||
Mapping_target | Y50D4C | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00005024 | |||||||
Transcript | Y50D4C.4b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50D4C.4b.1:c.1156C>T | ||||||||
HGVSp | CE50778:p.Gln386Ter | ||||||||
cDNA_position | 1156 | ||||||||
CDS_position | 1156 | ||||||||
Protein_position | 386 | ||||||||
Exon_number | 4/4 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Y50D4C.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50D4C.4c.1:c.250C>T | ||||||||
HGVSp | CE50722:p.Gln84Ter | ||||||||
cDNA_position | 250 | ||||||||
CDS_position | 250 | ||||||||
Protein_position | 84 | ||||||||
Exon_number | 2/2 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Y50D4C.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50D4C.4a.1:c.2290C>T | ||||||||
HGVSp | CE35919:p.Gln764Ter | ||||||||
cDNA_position | 2302 | ||||||||
CDS_position | 2290 | ||||||||
Protein_position | 764 | ||||||||
Exon_number | 8/9 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | V | -19.9154 | ||||||
Mapping_data | In_multi_point | 3145 | |||||||
3146 | |||||||||
Description | Phenotype | WBPhenotype:0000040 | Paper_evidence | WBPaper00003405 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Some eggs fail to undergo cytokinesis | Paper_evidence | WBPaper00003405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00003405 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000052 | Paper_evidence | WBPaper00005800 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0000510 | Paper_evidence | WBPaper00005800 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson282 | |||||||||
Remark | morphology of L4 vulva abnormal (invagination considerably reduced) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Extracellular space between vulval cells reduced during L4 stage. | Paper_evidence | WBPaper00005800 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0000694 | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003405 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000862 | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Adults are visibly bloated with unlaid eggs | Paper_evidence | WBPaper00003405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003405 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001078 | Paper_evidence | WBPaper00005800 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
Remark | Maternal WT copy of the gene rescues this phenotype. | Paper_evidence | WBPaper00005800 | ||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0001260 | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants contain oocyte-like cells less than half the size of normal oocytes | Paper_evidence | WBPaper00003405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000061 | PATO:0000460 | Paper_evidence | WBPaper00003405 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001360 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001523 | Paper_evidence | WBPaper00005800 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
Remark | Extracellular space between cell and eggshell reduced at 1-cell stage. Extracellular space between vulval cells reduced during L4 stage. | Paper_evidence | WBPaper00005800 | ||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0006001 | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003405 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000707 | Paper_evidence | WBPaper00031153 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous animals from heterozygous hermaphrodites do not exhibit pharyngeal development defects. | Paper_evidence | WBPaper00031153 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00003405 | ||||||||
WBPaper00031153 | |||||||||
WBPaper00005800 | |||||||||
Method | Substitution_allele |