WormBase Tree Display for Variation: WBVar00090566
expand all nodes | collapse all nodes | view schema
WBVar00090566 | Evidence | Paper_evidence | WBPaper00026688 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n2739 | ||||||
Other_name | CE20455:p.Arg304Ter | |||||||
B0454.1.1:c.910A>T | ||||||||
HGVSg | CHROMOSOME_II:g.3058824A>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y25C1A | ||||
Flanking_sequences | tttagtgctcagccggcgccggcgccagtt | gagaggccccaagcccagttgtggagaatg | ||||||
Mapping_target | Y25C1A | |||||||
Type_of_mutation | Substitution | a | t | Paper_evidence | WBPaper00026688 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002997 | ||||||
Transcript | B0454.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0454.1.1:c.910A>T | |||||||
HGVSp | CE20455:p.Arg304Ter | |||||||
cDNA_position | 923 | |||||||
CDS_position | 910 | |||||||
Protein_position | 304 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Aga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Interactor | WBInteraction000052298 | |||||||
WBInteraction000052443 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00026688 | ||||
Forward_genetics | Screen for class A synMuv | Paper_evidence | WBPaper00026688 | |||||
Genetics | Interpolated_map_position | II | -8.63399 | |||||
Description | Phenotype_not_observed | WBPhenotype:0000700 | Paper_evidence | WBPaper00026688 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Class A synMuv. | Paper_evidence | WBPaper00026688 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00026688 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00026688 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026688 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00026688 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002997 Opal_UGA R(304) to stop | Paper_evidence | WBPaper00026688 | |||||
Method | Substitution_allele |