WormBase Tree Display for Variation: WBVar00090538
expand all nodes | collapse all nodes | view schema
WBVar00090538 | Name | Public_name | n2665 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F31E8.2b.1:c.806_807insCTTG | |||||||
CE02711:p.Gly271PhefsTer17 | ||||||||
F31E8.2a.1:c.806_807insCTTG | ||||||||
CE28229:p.Gly271PhefsTer17 | ||||||||
HGVSg | CHROMOSOME_II:g.6814500_6814501insCTTG | |||||||
Sequence_details | SMap | S_parent | Sequence | F31E8 | ||||
Flanking_sequences | gacaagttctcattccgcttggaaaaattg | tgggagctgttatcgaagaatggaaggata | ||||||
Mapping_target | F31E8 | |||||||
Type_of_mutation | Insertion | cttg | ||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027274 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004921 | ||||||
Transcript | F31E8.2b.1 | VEP_consequence | frameshift_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F31E8.2b.1:c.806_807insCTTG | |||||||
HGVSp | CE28229:p.Gly271PhefsTer17 | |||||||
cDNA_position | 806-807 | |||||||
CDS_position | 806-807 | |||||||
Protein_position | 269 | |||||||
Exon_number | 4/8 | |||||||
Codon_change | gat/gaCTTGt | |||||||
Amino_acid_change | D/DLX | |||||||
F31E8.2a.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F31E8.2a.1:c.806_807insCTTG | |||||||
HGVSp | CE02711:p.Gly271PhefsTer17 | |||||||
cDNA_position | 811-812 | |||||||
CDS_position | 806-807 | |||||||
Protein_position | 269 | |||||||
Exon_number | 5/10 | |||||||
Codon_change | gat/gaCTTGt | |||||||
Amino_acid_change | D/DLX | |||||||
Interactor (3) | ||||||||
Genetics | Interpolated_map_position | II | 0.115801 | |||||
Description | Phenotype | WBPhenotype:0001514 | Paper_evidence | WBPaper00002316 | ||||
Curator_confirmed | WBPerson128 | |||||||
Remark | defective synaptic vesicle endocytosis | Paper_evidence | WBPaper00002316 | |||||
Curator_confirmed | WBPerson128 | |||||||
Recessive | Paper_evidence | WBPaper00002316 | ||||||
Curator_confirmed | WBPerson128 | |||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001684 | Paper_evidence | WBPaper00002316 | ||||||
Curator_confirmed | WBPerson128 | |||||||
Remark | synaptic vesicle biogenesis unaffected | Paper_evidence | WBPaper00002316 | |||||
Curator_confirmed | WBPerson128 | |||||||
synaptic vesicle transport unaffected | Paper_evidence | WBPaper00002316 | ||||||
Curator_confirmed | WBPerson128 | |||||||
Reference | WBPaper00028886 | |||||||
WBPaper00004883 | ||||||||
WBPaper00002316 | ||||||||
Method | Insertion_allele |