WormBase Tree Display for Variation: WBVar00090503
expand all nodes | collapse all nodes | view schema
WBVar00090503 | Evidence | Paper_evidence | WBPaper00026863 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n2515 | ||||||
Other_name | CE27833:p.Pro344Leu | |||||||
CE31440:p.Pro384Leu | ||||||||
C37F5.1a.1:c.1151C>T | ||||||||
C37F5.1b.1:c.1031C>T | ||||||||
HGVSg | CHROMOSOME_IV:g.2276449G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C37F5 | ||||
Flanking_sequences | atttctatacttttcaggtgttccaattcc | gccggtctccgcattccaggccacaaatcc | ||||||
Mapping_target | C37F5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003160 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040576 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002990 | ||||||
Transcript | C37F5.1a.1 (12) | |||||||
C37F5.1b.1 (12) | ||||||||
Interactor | WBInteraction000002753 | |||||||
WBInteraction000002762 | ||||||||
WBInteraction000052120 | ||||||||
Genetics | Interpolated_map_position | IV | -8.49948 | |||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 11% of fertile animals (n=36) exhibited an egg laying defect. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 4% animals (n=27) are aberrant in induction of VPCs; <3 of the VPCs, which are induced in wild type animals (P5.p to P7.p), are induced in these animals, as scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Low | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lin-1(n2515) mutation did not result in rod-like larval lethality | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lin-1(n2515) mutation did not induce the "2 P11.p" phenotype where the P12 cell adopts a P11 cell fate | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 0% animals produced progeny (n=36). | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 0% animals display one or more ectopic pseudovulvae (n=131). | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001272 | Paper_evidence | WBPaper00026863 | ||||||
WBPaper00005344 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | On average 2.97 VCPs (n=27 animals) are induced to adopt a vulval cell fate, which is near that of wild type, (3/6 VPCs induced n=29). VPCs and fate adoption were scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
The lin-1(n2515) mutation resulted in the expected number (~3) of induced vulval precursor cells | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | |||||
WBPaper00005344 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Vulval induction was scored in late L3 to early L4 stage larvae, under Normarski optics. All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00005344 | |||||||
WBPaper00026863 | ||||||||
Method | Substitution_allele |