WormBase Tree Display for Variation: WBVar00090453
expand all nodes | collapse all nodes | view schema
WBVar00090453 | Evidence | Paper_evidence | WBPaper00026688 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n2376 | ||||||
Other_name | CE20455:p.Glu148Lys | |||||||
B0454.1.1:c.442G>A | ||||||||
HGVSg | CHROMOSOME_II:g.3058124G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | B0454 | ||||
Flanking_sequences | gcccaagtagaggcctatatgtggcgctgg | agttttacggctttattcgctactatcgag | ||||||
Mapping_target | B0454 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026688 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002997 | ||||||
Transcript | B0454.1.1 (12) | |||||||
Interactor | WBInteraction000052291 | |||||||
WBInteraction000052437 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00026688 | ||||
Forward_genetics | Screen for class A synMuv | Paper_evidence | WBPaper00026688 | |||||
Genetics | Interpolated_map_position | II | -8.63872 | |||||
Description | Phenotype_not_observed | WBPhenotype:0000700 | Paper_evidence | WBPaper00026688 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Class A synMuv. | Paper_evidence | WBPaper00026688 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00026688 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00026688 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00026688 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00026688 | |||||||
Remark | Mutant protein remains present by immunoblot. n2376 is stronger than apparent null alleles in sensitized assays, and may be function-specific | Paper_evidence | WBPaper00026688 | |||||
Method | Substitution_allele |