WormBase Tree Display for Variation: WBVar00090377
expand all nodes | collapse all nodes | view schema
WBVar00090377 | Evidence | Paper_evidence | WBPaper00001519 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n2195 | |||||||
Other_name | CE01784:p.Gly201Arg | ||||||||
C14F5.5.1:c.601G>A | |||||||||
HGVSg | CHROMOSOME_X:g.7960297C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C14F5 | |||||
Flanking_sequences | tggtgggaaggacagctgaacaacaggcgt | gaattttcccatccaactacgtatgccctt | |||||||
Mapping_target | C14F5 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001519 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027242 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004774 | |||||||
Transcript | C14F5.5.1 (12) | ||||||||
Interactor | WBInteraction000519177 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00001519 | |||||
Genetics | Interpolated_map_position | X | -0.823185 | ||||||
Description | Phenotype | WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weak Egl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001272 | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We scored the vulval lineage of P7.p in four different alleles of sem-5. Two alleles, n2019 and cs15, which cause a glycine to alanine substitution in the first SH3 domain and an opal stop in the second SH3 domain, respectively, cause polarity and induction defects, whereas n2195, which causes a glycine to arginine substitution in the second SH3 domain, yields neither polarity nor induction defects. The fourth allele, n1779, which causes a glutamate to lysine substitution in the SH2 domain, results in a 13% P-Rvl phenotype, affecting polarity, but not induction (Table 1). We thus used sem-5(n1779) as the canonical allele." | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We scored the vulval lineage of P7.p in four different alleles of sem-5. Two alleles, n2019 and cs15, which cause a glycine to alanine substitution in the first SH3 domain and an opal stop in the second SH3 domain, respectively, cause polarity and induction defects, whereas n2195, which causes a glycine to arginine substitution in the second SH3 domain, yields neither polarity nor induction defects. The fourth allele, n1779, which causes a glutamate to lysine substitution in the SH2 domain, results in a 13% P-Rvl phenotype, affecting polarity, but not induction (Table 1). We thus used sem-5(n1779) as the canonical allele." | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00001519 | ||||||||
WBPaper00044058 | |||||||||
Method | Substitution_allele |