WormBase Tree Display for Variation: WBVar00090334

WBVar00090334 Evidence: Paper_evidence: WBPaper00001519
  Name: Public_name: n2019
    Other_name: C14F5.5.1:c.179+1G>A
    HGVSg: CHROMOSOME_X:g.7961483C>T
  Sequence_details: SMap: S_parent: Sequence: C14F5
    Flanking_sequences: taattatattcgtatgactgaatgcaattg tatgttcgggaaaaaatagtttgacttttt
    Mapping_target: C14F5
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00001519
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00027153
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00004774
    Transcript: C14F5.5.1 VEP_consequence: splice_donor_variant
        VEP_impact: HIGH
        HGVSc: C14F5.5.1:c.179+1G>A
        Intron_number: 3/7
    Interactor (92)
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00001519
  Genetics: Interpolated_map_position: X -0.820155
  Description: Phenotype: WBPhenotype:0000414 Paper_evidence: WBPaper00003135
        Curator_confirmed: WBPerson2987
        Remark: sem-5(n2019) resulted in a 31% penetrant P12 to P11 cell fate transformation (Table 1A) Paper_evidence: WBPaper00003135
            Curator_confirmed: WBPerson2987
        Penetrance: Incomplete: 31% penetrance Paper_evidence: WBPaper00003135
              Curator_confirmed: WBPerson2987
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00003135
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0004410 PATO:0000460 Paper_evidence: WBPaper00003135
                Curator_confirmed: WBPerson2987
            WBbt:0004409 PATO:0000460 Paper_evidence: WBPaper00003135
                Curator_confirmed: WBPerson2987
      WBPhenotype:0000698 Paper_evidence: WBPaper00002375
        Curator_confirmed: WBPerson712
        Remark: On average less than one VPC adopts a vulval fate. Paper_evidence: WBPaper00002375
            Curator_confirmed: WBPerson712
      WBPhenotype:0001272 Paper_evidence: WBPaper00044058
        Curator_confirmed: WBPerson2987
        Remark: "We scored the vulval lineage of P7.p in four different alleles of sem-5. Two alleles, n2019 and cs15, which cause a glycine to alanine substitution in the first SH3 domain and an opal stop in the second SH3 domain, respectively, cause polarity and induction defects, whereas n2195, which causes a glycine to arginine substitution in the second SH3 domain, yields neither polarity nor induction defects. The fourth allele, n1779, which causes a glutamate to lysine substitution in the SH2 domain, results in a 13% P-Rvl phenotype, affecting polarity, but not induction (Table 1). We thus used sem-5(n1779) as the canonical allele." Paper_evidence: WBPaper00044058
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0006895 PATO:0000460 Paper_evidence: WBPaper00044058
                Curator_confirmed: WBPerson2987
      WBPhenotype:0002193 Paper_evidence: WBPaper00044058
        Curator_confirmed: WBPerson2987
        Remark: "We scored the vulval lineage of P7.p in four different alleles of sem-5. Two alleles, n2019 and cs15, which cause a glycine to alanine substitution in the first SH3 domain and an opal stop in the second SH3 domain, respectively, cause polarity and induction defects, whereas n2195, which causes a glycine to arginine substitution in the second SH3 domain, yields neither polarity nor induction defects. The fourth allele, n1779, which causes a glutamate to lysine substitution in the SH2 domain, results in a 13% P-Rvl phenotype, affecting polarity, but not induction (Table 1). We thus used sem-5(n1779) as the canonical allele." Paper_evidence: WBPaper00044058
            Curator_confirmed: WBPerson2987
        Penetrance: Incomplete: 33 Paper_evidence: WBPaper00044058
              Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0006895 PATO:0000460 Paper_evidence: WBPaper00044058
                Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0001060 Paper_evidence: WBPaper00003955
        Curator_confirmed: WBPerson712
      WBPhenotype:0001061 Paper_evidence: WBPaper00003955
        Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005670 PATO:0000460 Paper_evidence: WBPaper00003955
                Curator_confirmed: WBPerson712
      WBPhenotype:0001278 Paper_evidence: WBPaper00057074
        Curator_confirmed: WBPerson712
        Remark: neurons did not show a loss in unc-25::GFP expression Paper_evidence: WBPaper00057074
            Curator_confirmed: WBPerson712
        Image: WBPicture0000014913 Paper_evidence: WBPaper00057074
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005027 PATO:0000460 Paper_evidence: WBPaper00057074
                Curator_confirmed: WBPerson712
            WBbt:0005021 PATO:0000460 Paper_evidence: WBPaper00057074
                Curator_confirmed: WBPerson712
  Reference (11)
  Method: Substitution_allele