WormBase Tree Display for Variation: WBVar00090319
expand all nodes | collapse all nodes | view schema
WBVar00090319 | Evidence | Paper_evidence | WBPaper00003948 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1993 | |||||||
Other_name | C09G12.8b.1:c.569T>G | ||||||||
C09G12.8a.1:c.383T>G | |||||||||
CE16833:p.Val190Gly | |||||||||
CE16832:p.Val128Gly | |||||||||
HGVSg | CHROMOSOME_IV:g.3507386A>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09G12 | |||||
Flanking_sequences | cacaaagagccaaaaagagcaagtgtacgg | gctctaagatggggaaattggagcaaacaa | |||||||
Mapping_target | C09G12 | ||||||||
Type_of_mutation | Substitution | t | g | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (12) | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000424 | |||||||
Transcript | C09G12.8a.1 (12) | ||||||||
C09G12.8b.1 (12) | |||||||||
Interactor (30) | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000188 | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | >10% of gonadal arms were shorter than those of wild-type animals or were grossly disorganized (germ cells were dispersed inside the body cavity). | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00032090 | |||||||
WBPaper00003948 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000243 | Paper_evidence | WBPaper00050421 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | dying cells arrest at highly refractile stage; killer cells fail to engulf target cells; engulfment group B (ced-2,5,10: suppress vulvaless phenotype of lin-24, lin-33); extensive maternal rescue | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
persistent corpses in the pharynx of L1 (Supplemental Table 1) | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000301 | Paper_evidence | WBPaper00003948 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Distal tip cells did not follow a typical path, resulting in gonad arms that exhibited inappropriate turns, twists, or positions with in the body cavity. | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00041162 | |||||||
Curator_confirmed | WBPerson10621 | ||||||||
Remark | affects AIY synaptic vesicle clustering | Paper_evidence | WBPaper00041162 | ||||||
Curator_confirmed | WBPerson10621 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005413 | PATO:0000460 | Paper_evidence | WBPaper00041162 | ||||
Curator_confirmed | WBPerson10621 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00001438 | |||||||
WBPaper00038317 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Failure to engulf cell corpses | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Persistent cell corpses accumulate. | Paper_evidence | WBPaper00038317 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001438 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005739 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001438 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000037 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
WBPhenotype:0001346 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In light-sheet videos, we did not detect YFP-ACT-5END around lobes as they initially embedded into endodermal cells. However, YFP-ACT-5END enriched transiently at the necks of PGC lobes (Fig. 4f) just prior to the visible separation of PGC lobes from the cell body (Fig. 4h; 15/15 lobes in 6 embryos). In light-sheet videos of ced-10 mutants, only 13% of lobe necks accumulated YFP-ACT-5END (3/23 lobes in 6 embryos; Fig. 4g); these lobes underwent scission and were digested by endodermal cells, whereas lobes that failed to accumulate actin always persisted (Fig. 4h). These findings suggest that ced-10-dependent actin accumulation around lobe necks promotes lobe scission." | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | xnEx326 [Pend-1::yfp::act-5, pRF4]; YFP-ACT-5END (YFP-tagged endodermally expressed ACT-5 (actin)) | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In viable ced-10(n1993) hypomorphic mutant embryos, lobes formed normally and embedded properly into endodermal cells (Fig. 4a,b). However, a subset of PGC lobes persisted in 100% of ced-10(n1993) L1 larvae (n = 115; Supplementary Table 1), and PGC debris within endodermal cells was greatly reduced (Fig. 4a,b,e). Many of the persistent lobes in ced-10(n1993) L1 larvae (96/104 lobes in 44 L1) maintained a thin membrane attachment to the PGC cell body (Fig. 4b',b''), and 100% of persistent lobes recovered from photobleaching (n = 19 larvae; Fig. 4c), indicating that ced-10 is required for lobe scission. Persistent lobes in ced-10(n1993) mutants were rescued by expressing ced-10(+) in endodermal cells (Fig. 4d and Supplementary Fig. 4c), and analysis of rare intra-endodermal mosaic embryos indicated that ced-10(+) activity is required within cells where lobe scission occurs (n = 11 L1 larvae; Supplementary Fig. 4a-b)." | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000180 | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% axons were prematurely terminated and thickened (n>200). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00046150 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00046150 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited mild VD/DD axon guidance defects. | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | juIs73 | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Similar to actin, in light-sheet videos YFP-DYN-1END accumulation occurred shortly before lobe degradation commenced (6/6 embryos, 15/15 lobes; Fig. 6a). YFP-DYN-1END still accumulated at lobe necks in light-sheet videos of ced-10 mutants (6/6 embryos, 28/28 lobes; Fig. 6a), indicating that dynamin localization does not require lobe-neck actin." | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"By contrast, YFP-LST-4END accumulated normally in ced-10 mutants (Fig. 6e)." | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | xnEx338 [Pend-1::yfp::dyn-1, pRF4] | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
xnEx452 [Pend-1::lst-4::yfp, pRF4]; LST-4-YFP-END | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000520 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | no gross phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Animals did not have PLM branch defects. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% cell bodies and axons displayed a spread morphology or ectopic lamellipodia/filopodia-like structure (n>200). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001656 | Paper_evidence | WBPaper00003948 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Initiating and maintaining a trajectory is normal. | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (18) | |||||||||
Method | Substitution_allele |