WormBase Tree Display for Variation: WBVar00090290
expand all nodes | collapse all nodes | view schema
WBVar00090290 | Evidence | Paper_evidence | WBPaper00003698 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n1895 | |||||
Other_name | F43G9.14:n.56C>T | ||||||
F43G9.19:n.50G>A | |||||||
HGVSg | CHROMOSOME_I:g.8633348G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F43G9 | |||
Flanking_sequences | tagaaaatagacagacggcgttgaaattag | tatgatgtaacaggtcatgaactgtgtcac | |||||
Mapping_target | F43G9 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003698 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00195590 | |||||
WBGene00201162 | |||||||
Transcript | F43G9.19 | VEP_consequence | non_coding_transcript_exon_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | F43G9.19:n.50G>A | ||||||
cDNA_position | 50 | ||||||
Exon_number | 1/1 | ||||||
F43G9.14 | VEP_consequence | non_coding_transcript_exon_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | F43G9.14:n.56C>T | ||||||
cDNA_position | 56 | ||||||
Exon_number | 1/1 | ||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | I | 3.01058 | ||||
Mapping_data | In_multi_point | 1745 | |||||
1748 | |||||||
Reference | WBPaper00015203 | ||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000468 Genomic_neighbourhood | ||||||
Method | Substitution_allele |