WormBase Tree Display for Variation: WBVar00090257
expand all nodes | collapse all nodes | view schema
WBVar00090257 | Evidence | Paper_evidence | WBPaper00006107 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n1783 | ||||||
Other_name (21) | ||||||||
HGVSg | CHROMOSOME_X:g.11019962C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F58A3 | ||||
Flanking_sequences | gattgattggatgctgtacaggcgctggtc | gctttatgtcgttgttgagctgtgcaagca | ||||||
Mapping_target | F58A3 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027119 | |||||||
WBStrain00030708 | ||||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001184 | ||||||
Transcript (13) | ||||||||
Genetics | Interpolated_map_position | X | 2.85574 | |||||
Description | Phenotype | WBPhenotype:0000426 | Paper_evidence | WBPaper00006119 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Remark | Blocks increased di-phosphorylation of MPK-1 in response to clr-1(e1745) | Paper_evidence | WBPaper00006119 | |||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_assay | Genotype | clr-1(e1745) | Paper_evidence | WBPaper00006119 | ||||
Curator_confirmed | WBPerson1754 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Remark | Blocks protein degradation in response to clr-1(e1745) | Paper_evidence | WBPaper00006119 | |||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_assay | Genotype | clr-1(e1745) | Paper_evidence | WBPaper00006119 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_not_observed | WBPhenotype:0000245 | Paper_evidence | WBPaper00006107 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | This mutation does not significantly effect sex myoblast position. | Paper_evidence | WBPaper00006107 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000886 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Class IV allele. Soc, no other phenotype. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
WBPaper00006119 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPerson1754 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Does not block protein degradation in response to let-60(ga89) | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_assay | Genotype | let-60(ga89) | Paper_evidence | WBPaper00006119 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Reference | WBPaper00040284 | |||||||
WBPaper00006107 | ||||||||
WBPaper00015702 | ||||||||
WBPaper00006119 | ||||||||
WBPaper00015779 | ||||||||
WBPaper00023169 | ||||||||
Method | Substitution_allele |