WormBase Tree Display for Variation: WBVar00090254
expand all nodes | collapse all nodes | view schema
| WBVar00090254 | Evidence | Paper_evidence | WBPaper00001519 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n1779 | |||||||
| Other_name | CE01784:p.Glu90Lys | ||||||||
| C14F5.5.1:c.268G>A | |||||||||
| HGVSg | CHROMOSOME_X:g.7961224C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C14F5 | |||||
| Flanking_sequences | cgtgatggtcatttccttgtccgacagtgt | aaagtagtccaggagaattttcgatcagtg | |||||||
| Mapping_target | C14F5 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001519 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00027118 | ||||||||
| WBStrain00027128 | |||||||||
| WBStrain00030723 | |||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00004774 | |||||||
| Transcript | C14F5.5.1 (12) | ||||||||
| Interactor | WBInteraction000518928 | ||||||||
| WBInteraction000519114 | |||||||||
| WBInteraction000519178 | |||||||||
| WBInteraction000519190 | |||||||||
| WBInteraction000519191 | |||||||||
| WBInteraction000519192 | |||||||||
| WBInteraction000535558 | |||||||||
| WBInteraction000535562 | |||||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00001519 | |||||
| Genetics | Interpolated_map_position | X | -0.82076 | ||||||
| Mapping_data | In_2_point | 4454 | |||||||
| In_multi_point | 1538 | ||||||||
| 1539 | |||||||||
| 1583 | |||||||||
| In_pos_neg_data | 4455 | ||||||||
| Description | Phenotype | WBPhenotype:0000925 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00044058 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "By observing VNS::SYS-1 localization in sem- 5(n1779) mutants we found two out of 20 worms having an atypical localization of VNS::SYS-1, which reflects the small percentage of worms that have P-Rvl phenotype (13% P-Rvl). Because in wildtype worms VNS::SYS-1 invariably localized to the anterior daughter of P7.p, this result is physiologically relevant. In agreement with our model, no other VPCs show defective VNS::SYS-1 localization in a sem-5(n1779) background." | Paper_evidence | WBPaper00044058 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | VNS::SYS-1 | Paper_evidence | WBPaper00044058 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00006119 | |||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| Remark | Blocks muscle protein degradation induced by clr-1(e1745) | Paper_evidence | WBPaper00006119 | ||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| Phenotype_assay | Genotype | clr-1(e1745) | Paper_evidence | WBPaper00006119 | |||||
| Curator_confirmed | WBPerson1754 | ||||||||
| WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We scored the vulval lineage of P7.p in four different alleles of sem-5. Two alleles, n2019 and cs15, which cause a glycine to alanine substitution in the first SH3 domain and an opal stop in the second SH3 domain, respectively, cause polarity and induction defects, whereas n2195, which causes a glycine to arginine substitution in the second SH3 domain, yields neither polarity nor induction defects. The fourth allele, n1779, which causes a glutamate to lysine substitution in the SH2 domain, results in a 13% P-Rvl phenotype, affecting polarity, but not induction (Table 1). We thus used sem-5(n1779) as the canonical allele." | Paper_evidence | WBPaper00044058 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Penetrance | Low | 13 | Paper_evidence | WBPaper00044058 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001272 | Paper_evidence | WBPaper00044058 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We scored the vulval lineage of P7.p in four different alleles of sem-5. Two alleles, n2019 and cs15, which cause a glycine to alanine substitution in the first SH3 domain and an opal stop in the second SH3 domain, respectively, cause polarity and induction defects, whereas n2195, which causes a glycine to arginine substitution in the second SH3 domain, yields neither polarity nor induction defects. The fourth allele, n1779, which causes a glutamate to lysine substitution in the SH2 domain, results in a 13% P-Rvl phenotype, affecting polarity, but not induction (Table 1). We thus used sem-5(n1779) as the canonical allele." | Paper_evidence | WBPaper00044058 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00015019 | ||||||||
| WBPaper00013925 | |||||||||
| WBPaper00014797 | |||||||||
| WBPaper00006119 | |||||||||
| WBPaper00026326 | |||||||||
| WBPaper00015779 | |||||||||
| WBPaper00044058 | |||||||||
| Method | Substitution_allele |
