WormBase Tree Display for Variation: WBVar00090245
expand all nodes | collapse all nodes | view schema
WBVar00090245 | Evidence | Paper_evidence | WBPaper00025674 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1761 | |||||||
Other_name | C37F5.1b.1:c.1017+1G>A | ||||||||
C37F5.1a.1:c.1137+1G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.2277191C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C37F5 | |||||
Flanking_sequences | ggtaggactcccggtcttggcgagagtcag | ttggtttttttctaaatacgaaatatttat | |||||||
Mapping_target | C37F5 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003160 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00002990 | |||||||
Transcript | C37F5.1a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37F5.1a.1:c.1137+1G>A | ||||||||
Intron_number | 5/6 | ||||||||
C37F5.1b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37F5.1b.1:c.1017+1G>A | ||||||||
Intron_number | 4/5 | ||||||||
Interactor | WBInteraction000524405 | ||||||||
Genetics | Interpolated_map_position | IV | -8.49247 | ||||||
Description | Phenotype | WBPhenotype:0000216 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | defect in Bγ cell fate specification | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0001708 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00005255 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | lin-1(n1761gf) mutant animals generated fewer P5.p - P7.p descendant nuclei than wild type animals (Table 2) | Paper_evidence | WBPaper00005255 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 54% penetrant | Paper_evidence | WBPaper00005255 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008590 | PATO:0000460 | Paper_evidence | WBPaper00005255 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | dpy-20(e1282) | Paper_evidence | WBPaper00005255 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | decreased sIys145 expression in Bγ | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0010467 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Reference | WBPaper00035553 | ||||||||
WBPaper00005255 | |||||||||
WBPaper00025674 | |||||||||
Method | Substitution_allele |