WormBase Tree Display for Variation: WBVar00090244
expand all nodes | collapse all nodes | view schema
WBVar00090244 | Evidence | Paper_evidence | WBPaper00001768 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n1760 | ||||||
Other_name | CE03975:p.Ter210LysextTer? | |||||||
HGVSg | ||||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | ||||
Flanking_sequences | tttcaaatataaaacactctgtttcaggtc | aaatttggtttcaaaatcgacgaatgaagc | ||||||
Mapping_target | C07H6 | |||||||
Type_of_mutation | Substitution | t | a | Paper_evidence | WBPaper00001768 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004825 | |||||||
WBStrain00027110 | ||||||||
WBStrain00027111 | ||||||||
WBStrain00027284 | ||||||||
WBStrain00027285 | ||||||||
WBStrain00027286 | ||||||||
WBStrain00027288 | ||||||||
WBStrain00027300 | ||||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003024 | ||||||
Transcript | C07H6.7.2 | VEP_consequence | stop_lost | |||||
VEP_impact | HIGH | |||||||
SIFT | 1 | tolerated_low_confidence | ||||||
HGVSp | CE03975:p.Ter210LysextTer? | |||||||
cDNA_position | 733 | |||||||
CDS_position | 628 | |||||||
Protein_position | 210 | |||||||
Exon_number | 5/7 | |||||||
Codon_change | Taa/Aaa | |||||||
Amino_acid_change | */K | |||||||
C07H6.7.1 | VEP_consequence | stop_lost | ||||||
VEP_impact | HIGH | |||||||
SIFT | 1 | tolerated_low_confidence | ||||||
HGVSp | CE03975:p.Ter210LysextTer? | |||||||
cDNA_position | 671 | |||||||
CDS_position | 628 | |||||||
Protein_position | 210 | |||||||
Exon_number | 5/7 | |||||||
Codon_change | Taa/Aaa | |||||||
Amino_acid_change | */K | |||||||
Interactor (24) | ||||||||
Genetics | Interpolated_map_position | III | -0.681216 | |||||
Mapping_data | In_multi_point | 2217 | ||||||
In_pos_neg_data | 6697 | |||||||
Description | Phenotype (7) | |||||||
Phenotype_not_observed | WBPhenotype:0000111 | Paper_evidence | WBPaper00003331 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lin-39(n1760) mutation did not affect the expression of endogenous ges-1 in the embryonic anterior gut (Figure 3). | Paper_evidence | WBPaper00003331 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "lin-39 is not required for expression of ida-1::gfp in either sex, as ida-1::gfp is expressed at nearly wild-type levels in VCs and CAs in lin-39(n1760); ced-3(n1286) double mutants (Fig. 4G,H; Table 1, and data not shown)." | Paper_evidence | WBPaper00044285 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00044285 | |||||
Curator_confirmed | WBPerson2987 | |||||||
EQ_annotations | Anatomy_term (15) | |||||||
Phenotype_assay | Genotype | ced-3(n1286); inIs179 [Pida-1::GFP] | Paper_evidence | WBPaper00044285 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00003331 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lin-39(n1760) mutation did not affect the expression of transgenic ges-1(delta B) in the embryonic anterior gut (Figure 3). | Paper_evidence | WBPaper00003331 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | ges-1(delta B)::lacZ | Paper_evidence | WBPaper00003331 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00027236 | |||||||
WBPaper00028400 | ||||||||
WBPaper00022870 | ||||||||
WBPaper00014076 | ||||||||
WBPaper00017748 | ||||||||
WBPaper00003331 | ||||||||
WBPaper00013862 | ||||||||
WBPaper00001861 | ||||||||
WBPaper00001768 | ||||||||
WBPaper00044285 | ||||||||
Method | Substitution_allele |