WormBase Tree Display for Variation: WBVar00090244
expand all nodes | collapse all nodes | view schema
WBVar00090244 | Evidence | Paper_evidence | WBPaper00001768 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1760 | |||||||
Other_name | CE03975:p.Ter210LysextTer? | ||||||||
HGVSg | |||||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | |||||
Flanking_sequences | tttcaaatataaaacactctgtttcaggtc | aaatttggtttcaaaatcgacgaatgaagc | |||||||
Mapping_target | C07H6 | ||||||||
Type_of_mutation | Substitution | t | a | Paper_evidence | WBPaper00001768 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004825 | ||||||||
WBStrain00027110 | |||||||||
WBStrain00027111 | |||||||||
WBStrain00027284 | |||||||||
WBStrain00027285 | |||||||||
WBStrain00027286 | |||||||||
WBStrain00027288 | |||||||||
WBStrain00027300 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003024 | |||||||
Transcript | C07H6.7.2 | VEP_consequence | stop_lost | ||||||
VEP_impact | HIGH | ||||||||
SIFT | 1 | tolerated_low_confidence | |||||||
HGVSp | CE03975:p.Ter210LysextTer? | ||||||||
cDNA_position | 733 | ||||||||
CDS_position | 628 | ||||||||
Protein_position | 210 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | Taa/Aaa | ||||||||
Amino_acid_change | */K | ||||||||
C07H6.7.1 | VEP_consequence | stop_lost | |||||||
VEP_impact | HIGH | ||||||||
SIFT | 1 | tolerated_low_confidence | |||||||
HGVSp | CE03975:p.Ter210LysextTer? | ||||||||
cDNA_position | 671 | ||||||||
CDS_position | 628 | ||||||||
Protein_position | 210 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | Taa/Aaa | ||||||||
Amino_acid_change | */K | ||||||||
Interactor (24) | |||||||||
Genetics | Interpolated_map_position | III | -0.681216 | ||||||
Mapping_data (2) | |||||||||
Description | Phenotype | WBPhenotype:0000216 | Paper_evidence | WBPaper00044285 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The lin-39(n1760) null mutation affects cell fates in lin-39's expression domain in both sexes." | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000227 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male turning ability similar to CP neuron ablation; many missed and some sloppy. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000403 | Paper_evidence | WBPaper00028400 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Somata and processes of the ventral nerve cord are not serotonin-IR (immunoreactive), although the serotonin-IR neurons in the head and tail were normal. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00044285 | |||||||
Curator_confirmed | WBPerson48754 | ||||||||
Remark | Figure 4E, Ectopic FMRF-like peptide gene expression in VCNs; "Consistent with an apparent transformation of the fates of CAs [sic, should be "CPs"] 5 and 6 to that of CAs [sic, should be "CPs"] 7-9, flp-21::gfp expression expands to include CPs 5-6 in lin-39(n1760) mutants." Table 1; flp-21::gfp normally expressed only in CPs 7-9 in wild type males. | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson48754 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson48754 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004893 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||
Curator_confirmed | WBPerson48754 | ||||||||
WBbt:0004891 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson48754 | ||||||||
Phenotype_assay | Genotype | ynIs80 [flp-21::gfp] | Paper_evidence | WBPaper00044285 | |||||
Curator_confirmed | WBPerson48754 | ||||||||
WBPhenotype:0001376 | Paper_evidence | WBPaper00044285 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In males, neither tph-1::mCherry nor other markers of serotonergic fate ( cat-1::gfp , cat-4::gfp ,and bas-1::gfp ) are expressed in the lin-39(n1760) ventral cord." Normally males express all four reporters in CPs 1-6 (see Table 1), although CPs 1-4 undergo ectopic apoptosis in lin-39(n1760) mutants, so a conclusion can only be drawn for CPs 5-6 (see additional experiments where cell death is blocked by the ced-3(n1286) mutation) | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Expression of reporters normally seen in CA/CPs 1-4 is absent, of course, when P3-P6.aap die in lin-39 mutants because CA/CPs 1-4 are never generated. To see whether lin-39 function is necessary for expression of reporters in CA/CPs 1-4, we blocked programmed cell death with a ced-3 mutation: in lin-39(n1760); ced-3(n1286) double mutants, all P3-P8.aap cells survive. In these mutants, all CP neurons (CP1-CP6) lack serotonin immunoreactivity (data not shown) and fail to express tph-1::mCherry (Fig. 4; Table 1)." | Paper_evidence | WBPaper00044285 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004893 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004891 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004901 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004899 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004897 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004895 | PATO:0000460 | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | cccIs1 [tph-1::mCherry] OR otIs226 [bas-1::GFP] OR otIs225 [cat-4::gfp] OR otIs221 [cat-1::GFP] | Paper_evidence | WBPaper00044285 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
ced-3(n1286); cccIs1 [tph-1::mCherry] | Paper_evidence | WBPaper00044285 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002610 | Paper_evidence | WBPaper00001768 | |||||||
Curator_confirmed | WBPerson48754 | ||||||||
Remark | In hermaphrodites P3-P8.aap cells undergo apoptosis (Table 1b); in males P2-P6.aap cells undergo apoptosis (Table 1d) | Paper_evidence | WBPaper00001768 | ||||||
Curator_confirmed | WBPerson48754 | ||||||||
EQ_annotations | Anatomy_term (11) | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00001768 | |||||
Curator_confirmed | WBPerson48754 | ||||||||
Phenotype_not_observed | WBPhenotype:0000111 | Paper_evidence | WBPaper00003331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-39(n1760) mutation did not affect the expression of endogenous ges-1 in the embryonic anterior gut (Figure 3). | Paper_evidence | WBPaper00003331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00044285 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "lin-39 is not required for expression of ida-1::gfp in either sex, as ida-1::gfp is expressed at nearly wild-type levels in VCs and CAs in lin-39(n1760); ced-3(n1286) double mutants (Fig. 4G,H; Table 1, and data not shown)." | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00044285 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term (15) | ||||||||
Phenotype_assay | Genotype | ced-3(n1286); inIs179 [Pida-1::GFP] | Paper_evidence | WBPaper00044285 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00003331 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-39(n1760) mutation did not affect the expression of transgenic ges-1(delta B) in the embryonic anterior gut (Figure 3). | Paper_evidence | WBPaper00003331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | ges-1(delta B)::lacZ | Paper_evidence | WBPaper00003331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00027236 | ||||||||
WBPaper00028400 | |||||||||
WBPaper00022870 | |||||||||
WBPaper00014076 | |||||||||
WBPaper00017748 | |||||||||
WBPaper00003331 | |||||||||
WBPaper00013862 | |||||||||
WBPaper00001861 | |||||||||
WBPaper00001768 | |||||||||
WBPaper00044285 | |||||||||
Method | Substitution_allele |