WormBase Tree Display for Variation: WBVar00090170
expand all nodes | collapse all nodes | view schema
WBVar00090170 | Evidence | Paper_evidence | WBPaper00032921 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1439 | |||||||
Other_name | C08C3.7:n.11_41delinsATTTTGGAATGTTCCAGAACTTTCTAGAAAAATCGAGAAA | ||||||||
HGVSg | CHROMOSOME_III:g.7800655_7800685delinsTTTCTCGATTTTTCTAGAAAGTTCTGGAACATTCCAAAAT | ||||||||
Sequence_details | SMap | S_parent | Sequence | C08C3 | |||||
Flanking_sequences | ctgttaatatttttacgagccattgtattat | aacggagaatcattttaaattttttgttgtt | |||||||
Mapping_target | C08C3 | ||||||||
Type_of_mutation | Insertion | tttctcgatttttctagaaagttctggaacattccaaaat | |||||||
Deletion | ggaacccggtgttattatgattgttattaac | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00196265 | |||||||
Transcript | C08C3.7 | VEP_consequence | non_coding_transcript_exon_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C08C3.7:n.11_41delinsATTTTGGAATGTTCCAGAACTTTCTAGAAAAATCGAGAAA | ||||||||
cDNA_position | 11-41 | ||||||||
Exon_number | 1/1 | ||||||||
Genetics | Interpolated_map_position | III | -0.586327 | ||||||
Mapping_data | In_multi_point | 1397 | |||||||
1494 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001133 | |||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00001133 | ||||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 92 | 92 | Paper_evidence | WBPaper00001133 | |||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show a 42 percent drop in brood size (compared to wild-type) | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000339 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weakest allele | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN maturation is abnormal. No hood formation and nucleolar growth is observed | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Serotonin levels are reduced in HSNs (determined immunocytochemically). | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSNs fail to arrive at their final destination (between P5/6 and V4) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001414 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weakest allele, males can mate | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00014215 | ||||||||
WBPaper00013781 | |||||||||
WBPaper00001105 | |||||||||
WBPaper00001133 | |||||||||
WBPaper00013865 | |||||||||
WBPaper00018228 | |||||||||
Remark | n1439 contains an ~800bp insertion of a tandem repeat (19 near-identical copies of a 40 base repeat element-shown above) and a deletion of 37 bp at the insertion site, both ~13.8 kb upstream of the egl-5 coding region. | ||||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001174 Genomic_neighbourhood | |||||||||
Method | Deletion_and_insertion_allele |