WormBase Tree Display for Variation: WBVar00089986
expand all nodes | collapse all nodes | view schema
WBVar00089986 | Name | Public_name | n1162 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE01203:p.Gln80Ter | |||||||
CE38154:p.Gln80Ter | ||||||||
C35D10.9a.1:c.238C>T | ||||||||
C35D10.9b.1:c.238C>T | ||||||||
HGVSg | CHROMOSOME_III:g.4852562C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C35D10 | ||||
Flanking_sequences | ccactcatcgactttttcaactacaacaat | aaagtcaccttgctgatttcctcgaagact | ||||||
Mapping_target | C35D10 | |||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson2599 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022157 | |||||||
WBStrain00024083 | ||||||||
WBStrain00026975 | ||||||||
WBStrain00026976 | ||||||||
WBStrain00026977 | ||||||||
WBStrain00055822 | ||||||||
Laboratory | MT | |||||||
CA | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000418 | ||||||
Transcript | C35D10.9b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C35D10.9b.1:c.238C>T | |||||||
HGVSp | CE38154:p.Gln80Ter | |||||||
cDNA_position | 238 | |||||||
CDS_position | 238 | |||||||
Protein_position | 80 | |||||||
Exon_number | 1/8 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
C35D10.9a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C35D10.9a.1:c.238C>T | |||||||
HGVSp | CE01203:p.Gln80Ter | |||||||
cDNA_position | 238 | |||||||
CDS_position | 238 | |||||||
Protein_position | 80 | |||||||
Exon_number | 1/9 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor (30) | ||||||||
Genetics | Interpolated_map_position | III | -2.41857 | |||||
Mapping_data | In_2_point | 1627 | ||||||
In_multi_point | 871 | |||||||
1078 | ||||||||
1079 | ||||||||
2308 | ||||||||
3206 | ||||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00046863 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | ced-4(n1162) did not affect life span (Figure 7A) | Paper_evidence | WBPaper00046863 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00038332 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals produced viable progeny. | Paper_evidence | WBPaper00038332 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | ced-4(n1162) did not affect expression of the hsp-60::GFP transgene (Figure 6D) | Paper_evidence | WBPaper00046863 | |||||
Curator_confirmed | WBPerson2987 | |||||||
ced-4(n1162) did not affect expression of the hsp-60::GFP transgene by the nduf-7(et19) mutation (Figure 6D) | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | hsp-60::GFP | Paper_evidence | WBPaper00046863 | ||||
Curator_confirmed | WBPerson2987 | |||||||
hsp-60::GFP; nduf-7(et19) | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00038332 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals displayed normal morphology. | Paper_evidence | WBPaper00038332 | |||||
Curator_confirmed | WBPerson712 | |||||||
no gross phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | ced-4(n1162) did not affect the response to fluvastatin (Figure S2) | Paper_evidence | WBPaper00046863 | |||||
Curator_confirmed | WBPerson2987 | |||||||
ced-4(n1162) did not affect the resistance to fluvastatin conferred by the nduf-7(et19) mutation (Figure S2) | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003950 | Paper_evidence | WBPaper00046863 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | nduf-7(et19) | Paper_evidence | WBPaper00046863 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000590 | Paper_evidence | WBPaper00038332 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00038332 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals displayed normal fertility. | Paper_evidence | WBPaper00038332 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | germline is immortal at 20 and 25 degrees Celsius | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Strains propagated for many generations and checked for sterility | Paper_evidence | WBPaper00028759 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001651 | Paper_evidence | WBPaper00031571 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not progress to L4 (data not shown). | Paper_evidence | WBPaper00031571 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Embryos were transferred to plates containing 5-FU and remaining larva were counted after 72 hours. | Paper_evidence | WBPaper00031571 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference (24) | ||||||||
Remark | The allele has already been described in the Yuan and Horvitz 1992 paper. However, both in Figure 4 and Table 2 it is presented as a C to T transition at nucleotide 1131 that changes codon 40. Moreover, the changed codon is shown to be a CAT in the Figure and a CAA in the Table. It turns out that the affected nucleotide and codon are numbers 238 and 80, respectively, as shown by the information above. | Person_evidence | WBPerson2599 | |||||
Method | Substitution_allele |