WormBase Tree Display for Variation: WBVar00089986

WBVar00089986 Name: Public_name: n1162
    Other_name: CE01203:p.Gln80Ter
      CE38154:p.Gln80Ter
      C35D10.9a.1:c.238C>T
      C35D10.9b.1:c.238C>T
    HGVSg: CHROMOSOME_III:g.4852562C>T
  Sequence_details: SMap: S_parent: Sequence: C35D10
    Flanking_sequences: ccactcatcgactttttcaactacaacaat aaagtcaccttgctgatttcctcgaagact
    Mapping_target: C35D10
    Type_of_mutation: Substitution: C T Person_evidence: WBPerson2599
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00022157
      WBStrain00024083
      WBStrain00026975
      WBStrain00026976
      WBStrain00026977
      WBStrain00055822
    Laboratory: MT
      CA
    Status: Live
  Affects: Gene: WBGene00000418
    Transcript: C35D10.9b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C35D10.9b.1:c.238C>T
        HGVSp: CE38154:p.Gln80Ter
        cDNA_position: 238
        CDS_position: 238
        Protein_position: 80
        Exon_number: 1/8
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      C35D10.9a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C35D10.9a.1:c.238C>T
        HGVSp: CE01203:p.Gln80Ter
        cDNA_position: 238
        CDS_position: 238
        Protein_position: 80
        Exon_number: 1/9
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor (30)
  Genetics: Interpolated_map_position: III -2.41857
    Mapping_data: In_2_point: 1627
      In_multi_point: 871
        1078
        1079
        2308
        3206
  Description: Phenotype (16)
    Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: ced-4(n1162) did not affect life span (Figure 7A) Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000062 Paper_evidence: WBPaper00038332
        Curator_confirmed: WBPerson712
        Remark: Animals produced viable progeny. Paper_evidence: WBPaper00038332
            Curator_confirmed: WBPerson712
      WBPhenotype:0000306 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: ced-4(n1162) did not affect expression of the hsp-60::GFP transgene (Figure 6D) Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
          ced-4(n1162) did not affect expression of the hsp-60::GFP transgene by the nduf-7(et19) mutation (Figure 6D) Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: hsp-60::GFP Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
            hsp-60::GFP; nduf-7(et19) Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000520 Paper_evidence: WBPaper00038332
        Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Animals displayed normal morphology. Paper_evidence: WBPaper00038332
            Curator_confirmed: WBPerson712
          no gross phenotype Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000523 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: ced-4(n1162) did not affect the response to fluvastatin (Figure S2) Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
          ced-4(n1162) did not affect the resistance to fluvastatin conferred by the nduf-7(et19) mutation (Figure S2) Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00003950 Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: nduf-7(et19) Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000590 Paper_evidence: WBPaper00038332
        Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00038332
        Curator_confirmed: WBPerson712
        Remark: Animals displayed normal fertility. Paper_evidence: WBPaper00038332
            Curator_confirmed: WBPerson712
      WBPhenotype:0000966 Paper_evidence: WBPaper00028759
        Curator_confirmed: WBPerson557
        Remark: germline is immortal at 20 and 25 degrees Celsius Paper_evidence: WBPaper00028759
            Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: Strains propagated for many generations and checked for sterility Paper_evidence: WBPaper00028759
              Curator_confirmed: WBPerson557
      WBPhenotype:0001651 Paper_evidence: WBPaper00031571
        Curator_confirmed: WBPerson712
        Remark: Animals did not progress to L4 (data not shown). Paper_evidence: WBPaper00031571
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Embryos were transferred to plates containing 5-FU and remaining larva were counted after 72 hours. Paper_evidence: WBPaper00031571
              Curator_confirmed: WBPerson712
  Reference (24)
  Remark: The allele has already been described in the Yuan and Horvitz 1992 paper. However, both in Figure 4 and Table 2 it is presented as a C to T transition at nucleotide 1131 that changes codon 40. Moreover, the changed codon is shown to be a CAT in the Figure and a CAA in the Table. It turns out that the affected nucleotide and codon are numbers 238 and 80, respectively, as shown by the information above. Person_evidence: WBPerson2599
  Method: Substitution_allele