WormBase Tree Display for Variation: WBVar00089936
expand all nodes | collapse all nodes | view schema
WBVar00089936 | Evidence | Paper_evidence | WBPaper00002370 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1068 | |||||||
Other_name | CE45947:p.Trp401Ter | ||||||||
F28C1.2b.1:c.1203G>A | |||||||||
CE24928:p.Trp401Ter | |||||||||
F28C1.2c.1:c.1203G>A | |||||||||
F28C1.2a.1:c.1203G>A | |||||||||
CE46003:p.Trp401Ter | |||||||||
HGVSg | CHROMOSOME_V:g.12457329C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F28C1 | |||||
Flanking_sequences | tccatggattaacgatactgttgatttttg | caacatgataaaatgtgagtttctagagtt | |||||||
Mapping_target | F28C1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002370 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001179 | |||||||
Transcript | F28C1.2c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F28C1.2c.1:c.1203G>A | ||||||||
HGVSp | CE46003:p.Trp401Ter | ||||||||
cDNA_position | 1395 | ||||||||
CDS_position | 1203 | ||||||||
Protein_position | 401 | ||||||||
Exon_number | 8/12 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F28C1.2b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F28C1.2b.1:c.1203G>A | ||||||||
HGVSp | CE45947:p.Trp401Ter | ||||||||
cDNA_position | 1203 | ||||||||
CDS_position | 1203 | ||||||||
Protein_position | 401 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F28C1.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F28C1.2a.1:c.1203G>A | ||||||||
HGVSp | CE24928:p.Trp401Ter | ||||||||
cDNA_position | 1395 | ||||||||
CDS_position | 1203 | ||||||||
Protein_position | 401 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | V | 4.25508 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The penetrance of the egg-laying defect in n1068 heterozygotes is heat-sensitive (especially at 25 C). See Table 7 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | As shown in Table 5, 9 percent of heterozygotes are Egl. Under homozygous conditions, 100 percent of hermaphrodites are Egl | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show a 35 percent drop in brood size (compared to wild-type) | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | males mate poorly (mating efficiency is 25 percent) | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | See Table 1 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 90 | 90 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 7.5 mg/ml serotonin | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001133 | ||||||||
WBPaper00016261 | |||||||||
Method | Substitution_allele |