WormBase Tree Display for Variation: WBVar00089796
expand all nodes | collapse all nodes | view schema
WBVar00089796 | Evidence | Paper_evidence | WBPaper00002223 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n836 | |||||
Other_name (24) | |||||||
HGVSg | CHROMOSOME_II:g.11920582_11920654del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y17G7A | |||
Flanking_sequences | tgtgacctttaaaaaaactgaaatttccag | actattgcggcaagaagttcactcagctat | |||||
Mapping_target | Y17G7A | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003015 | |||||
Transcript (12) | |||||||
Interactor | WBInteraction000505113 | ||||||
WBInteraction000505117 | |||||||
Genetics | Interpolated_map_position | II | 4.13767 | ||||
Mapping_data | In_pos_neg_data | 1356 | |||||
1385 | |||||||
1417 | |||||||
2360 | |||||||
2422 | |||||||
2423 | |||||||
2424 | |||||||
2425 | |||||||
Description | Phenotype | WBPhenotype:0000007 | Paper_evidence | WBPaper00001396 | |||
Curator_confirmed | WBPerson469 | ||||||
Remark | Vulva fails to form and a protruding blip is observed | Paper_evidence | WBPaper00001396 | ||||
Curator_confirmed | WBPerson469 | ||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00001396 | |||||
Curator_confirmed | WBPerson469 | ||||||
Remark | Vulva fails to form and a protruding blip is observed | Paper_evidence | WBPaper00001396 | ||||
Curator_confirmed | WBPerson469 | ||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00001396 | |||||
Curator_confirmed | WBPerson469 | ||||||
Remark | Vulva fails to form and a protruding blip is observed | Paper_evidence | WBPaper00001396 | ||||
Curator_confirmed | WBPerson469 | ||||||
Phenotype_not_observed | WBPhenotype:0001432 | Paper_evidence | WBPaper00027716 | ||||
Curator_confirmed | WBPerson48 | ||||||
Reference | WBPaper00002223 | ||||||
WBPaper00014232 | |||||||
WBPaper00027716 | |||||||
WBPaper00016535 | |||||||
WBPaper00014111 | |||||||
WBPaper00001396 | |||||||
Method | Deletion_allele |