WormBase Tree Display for Variation: WBVar00089700

WBVar00089700 Evidence: Paper_evidence: WBPaper00002413
  Name: Public_name: n717
    Other_name: C48D1.2b.1:c.562-1G>A
      C48D1.2a.1:c.1210-1G>A
    HGVSg: CHROMOSOME_IV:g.13200009C>T
  Sequence_details: SMap: S_parent: Sequence: C48D1
    Flanking_sequences: tttttaaatgataattaataaatttttgca caagtgtggagaaagaagccgagccaagct
    Mapping_target: C48D1
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00002413
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005600
      WBStrain00005836
      WBStrain00026860
      WBStrain00026968
      WBStrain00027213
      WBStrain00027223
      WBStrain00027232
      WBStrain00027287
      WBStrain00040671
      WBStrain00040674
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00000417
    Transcript: C48D1.2a.1 VEP_consequence: splice_acceptor_variant
        VEP_impact: HIGH
        HGVSc: C48D1.2a.1:c.1210-1G>A
        Intron_number: 7/9
      C48D1.2b.1 VEP_consequence: splice_acceptor_variant
        VEP_impact: HIGH
        HGVSc: C48D1.2b.1:c.562-1G>A
        Intron_number: 3/4
    Interactor (29)
  Genetics: Interpolated_map_position: IV 8.46245
    Mapping_data: In_multi_point: 689
        690
        896
      In_pos_neg_data: 831
  Description: Phenotype (15)
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00038332
        Curator_confirmed: WBPerson712
        Remark: Animals produced viable progeny. Paper_evidence: WBPaper00038332
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: No gross phenotype. Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000590 Paper_evidence: WBPaper00038332
        Curator_confirmed: WBPerson712
      WBPhenotype:0000966 Paper_evidence: WBPaper00028759
        Curator_confirmed: WBPerson557
        Remark: germline is immortal at 20 and 25 degrees Celsius Paper_evidence: WBPaper00028759
            Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: Strains propagated for many generations and checked for sterility Paper_evidence: WBPaper00028759
              Curator_confirmed: WBPerson557
      WBPhenotype:0001381 Paper_evidence: WBPaper00046527
        Curator_confirmed: WBPerson2987
        Remark: ced-3(n717) mutant worms were not resistant to anoxia exposure when fed a glucose-supplemented diet (Figure S1C) Paper_evidence: WBPaper00046527
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00003916 Paper_evidence: WBPaper00046527
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001650 Paper_evidence: WBPaper00031571
        Curator_confirmed: WBPerson712
        Remark: Germ cells are condensed and unhealthy although not as severely altered as those of at wild type or ced-9 animals. Paper_evidence: WBPaper00031571
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on plates containing 400nM 5-FU for 12 hours from late L4 stage. Paper_evidence: WBPaper00031571
              Curator_confirmed: WBPerson712
      WBPhenotype:0001651 Paper_evidence: WBPaper00031571
        Curator_confirmed: WBPerson712
        Remark: Animals did not progress to L4 (data not shown). Paper_evidence: WBPaper00031571
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Embryos were transferred to plates containing 5-FU and remaining larva were counted after 72 hours. Paper_evidence: WBPaper00031571
              Curator_confirmed: WBPerson712
      WBPhenotype:0001851 Paper_evidence: WBPaper00027700
        Curator_confirmed: WBPerson2021
        Remark: Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans Paper_evidence: WBPaper00027700
            Curator_confirmed: WBPerson2021
        EQ_annotations: Anatomy_term: WBbt:0006748 PATO:0000460 Paper_evidence: WBPaper00027700
                Curator_confirmed: WBPerson2021
          Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00027700
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 100-400 Gy radiation Paper_evidence: WBPaper00027700
              Curator_confirmed: WBPerson2021
      WBPhenotype:0002486 Paper_evidence: WBPaper00050421
        Curator_confirmed: WBPerson2987
        Remark: "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') Paper_evidence: WBPaper00050421
            Curator_confirmed: WBPerson2987
        Variation_effect: Predicted_null_via_sequence: Paper_evidence: WBPaper00050421
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0004576 PATO:0000460 Paper_evidence: WBPaper00050421
                Curator_confirmed: WBPerson2987
            WBbt:0004575 PATO:0000460 Paper_evidence: WBPaper00050421
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00050421
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. Paper_evidence: WBPaper00050421
              Curator_confirmed: WBPerson2987
  Reference (33)
  Method: Substitution_allele