WormBase Tree Display for Variation: WBVar00089691
expand all nodes | collapse all nodes | view schema
WBVar00089691 | Evidence | Paper_evidence | WBPaper00001768 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n709 | ||||||
Other_name | C07H6.7.2:c.-1G>A | |||||||
C07H6.7.1:c.1-1G>A | ||||||||
HGVSg | CHROMOSOME_III:g.7534701C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | ||||
Flanking_sequences | tatcaatcactttcactcgttttcactcca | atgaccacatcaacatcaccgtcatccaca | ||||||
Mapping_target | C07H6 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001768 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026857 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003024 | ||||||
Transcript (2) | ||||||||
Interactor | WBInteraction000002755 | |||||||
WBInteraction000002764 | ||||||||
WBInteraction000500077 | ||||||||
WBInteraction000500078 | ||||||||
WBInteraction000521976 | ||||||||
WBInteraction000535543 | ||||||||
WBInteraction000535544 | ||||||||
Genetics | Interpolated_map_position | III | -0.673654 | |||||
Description | Phenotype (21) | |||||||
Phenotype_not_observed | WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lin-39(n709) mutation did not induce the "2 P11.p" phenotype where the P12 cell adopts a P11 cell fate | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001816 | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Egg-laying events were still strongly correlated with HSN activity. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Combined fluorescent and visible microscopy was used to view both the Ca2+ signal and egg-laying events simultaneously. Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00043908 | |||||||
WBPaper00005277 | ||||||||
WBPaper00005344 | ||||||||
WBPaper00016118 | ||||||||
WBPaper00014076 | ||||||||
WBPaper00032221 | ||||||||
WBPaper00016177 | ||||||||
WBPaper00015250 | ||||||||
WBPaper00005609 | ||||||||
Method | Substitution_allele |